Рэп гюнтера: Текст песни Kick Buttowski — Рэп Гюнтера перевод, слова песни, видео, клип

Содержание

Текст песни Kick Buttowski — Рэп Гюнтера перевод, слова песни, видео, клип

— Он не посмеет

…ее давай ага …что

Рос Я не жестоким,
Хорошым Я рос.
Но к Бродяге – проходимцу,
Есть серьезный у меня вопрос:
Почему зовешь меня девчонкой?!

(Гюнтер кусает бродягу)

Я вечно улыбаюсь
Когда все ругаются
Думаете, Я – клоун?!
Думаете, мне всё это нравится?!
Может быть, думаете,
Гюнтер не кусается?!

Чик-чики Чи-чи – Чикарелли – Чикарелли

— Ух, ты Гюнтер…
— Это не все:

Изюм в печенье –
О, боже, мама, что это такое?
Я не люблю изюм, а еще цукаты.
Неужели мне теперь помогут только адвокаты.
Твое лицо будет в слезах,
Когда склонится Чаша Правосудия на весах:
Будет строгим решение Суда,
Ведь Рецепт Печения у всех на устах –
Так что мама не пеки их так!

Е — е не пеки их так
Зачем — а не пеки их так
Е мам прошу

А наша мисс ФицПатрик вечно говорит:
Гюнтер на уроках не работает, а спит.
Зачем претензии предъявляете мне:
Все прекрасно знают, Мозг – работает во сне.
Легко обидеть хорошего человека
Речи ваши гладки,-
Поступки ваши гадки.

В место вкуса шоколадки,
На губах горечь от ваших обид
А ими я ем – мой обед (Гюнтер кусает бутерброд).
Пути – ту – ту

— He would not dare

… Yeah … it let that

Ros I am not cruel,
Well I grew up.
But Rolling Stone — adventurer,
There are serious I have a question:
Why are calling me a girl ?!

(Gunther bites tramp)

I always smile
When all swear
Do you think I am — a clown ?!
Do you think, I do not like it ?!
Maybe, you think,
Gunther does not bite ?!

Chick-Chiki Chi Chi — Chikarelli — Chikarelli

— Wow … Gunter
— That’s not all:

Raisins cookies —
Oh, God, Mom, what is it?
I do not like raisins, candied fruit and more.
Do I now only help lawyers.
Your face will be in tears,
When the bow Bowl of Justice on the scale:
There is a strict decision of the Court,
For cookie recipe on everyone’s lips —

So mom did not bake them so!

E — ie not bake them so
Why — and not bake them so
E moms ask

And our Miss Fitzpatrick always says:
Gunther in the classroom is not working, and sleeping.
What claim is presented to me,
Everybody knows the brain — runs in his sleep.
It is easy to offend a good man
Your words are smooth —
The actions of your nasty.
In place of the taste of chocolate,
On the lips of the bitterness of your offense
And I eat them — my dinner (Gunter biting a sandwich).
Path — the — the

Новый сериал «Эйфория» с Зендаей — американская «Школа» о жизни подростков в эпоху постправды и мефедрона

На постере сериала «Эйфория» по лицу исполнительницы главной роли Зендаи (певица, принцесса телеканала Disney, звезда нового «Человека-паука», видимо, самая известная молодая (22 года) актриса прямо сейчас) бежит крупная слеза, а справа прилеплена страза. Это кино о поколении красивых, но грустных, танцующих на пире во время чумы, испытывающих депрессивное псевдосчастье на постнаркотических отходняках.

«Эйфорию» можно описать как экранизацию возмутительно прекрасной композиции «Девочка с каре» исполнителя МУККА. Пусть даже американские продюсеры не подозревают о ее существовании, этот сериал прекрасно описывает и тех ребят, что зависают в Яме на Китай-городе, и всех тех, о ком поет Pharaoh, Элджей и прочие (а «Эйфорию», в свою очередь, продюсировали зарубежные рэперы Дрейк и Future the Prince).

С тех пор как вышел сериал «Чернобыль», в фейсбуках российских кинематографистов не утихают стенания о том, что такой сериал должны были выпустить мы. Но если бы «Эйфорию» сняли в России, уверены, возмущению не было бы предела. Стоит только вспомнить скандал вокруг близкой по духу «Школы» Валерии Гай Германики — выйди она сейчас, фейсбук-общественность заклевала бы сериал за «неправдоподобие» — ведь «у нас такого не бывает, у нас все дети приличные».

«Эйфория» использует классические тропы молодежного кино: половозрелые актеры идеальной внешности возраста 20+, играющие школьников; любовные интриги и терзания; подростковые переживания про внешность, учебу, родителей и будущее. Но в то же время авторы не занимаются эйджизмом, а показывают героев цельными, пусть пока не дооформившимися личностями примерно с теми же проблемами, что и у их родителей: сексуальные затыки и перверсии, зависимости от разных лекарств и веществ.

С проблемы детской наркомании «Эйфория», собственно, и начинается: 17-летняя Ру (Зендая), подсевшая еще при живом отце на разные антидепрессанты и другие веселые таблетки, а позже окончательно слетевшая с катушек, после передозировки и рехаба возвращается в родной городок. За кадром она же рассказывает о судьбах других ее сверстников: новой подруги Джулс (Гюнтер Шаффер, модель и ЛГБТ-активистка), трансгендерной девушки, которая знакомится в гей-приложении с мужчинами, но выясняется, что привлекает она только женатых пожилых мужиков-абьюзеров со своими тараканами; корпулентной Лекси (Мод Апатоу, 21-летняя дочь известного комедиографа Джадда Апатоу), которая не была популярна в школе, но затем ее amature-порно попадает в сеть и она обнаруживает, что может зарабатывать на вебкаме; и так далее.

Это одновременно экранизация и реальных обстоятельств жизни тинейджеров эпохи клауд-рэпа, и экранизация их мечтаний, иллюзий о красивом лайфстайле из сторис знаменитостей вроде Дэна Билзеряна, где все пьют, дуют и трахаются. В «Эйфории» дети в свете неона (отдаленно сериал смахивает и на «Слишком стар, чтобы умереть молодым» Николаса Виндинга Рефна) обильно употребляют, шлют друг другу нюдсы (которые, по меткому выражению главной героини, сегодня превратились в «валюту любви») и даже в мыслях не задумываются о своем будущем, потому что им, кажется, уже очевидно: ни о каком будущем во времена постправды и мефедрона мечтать нельзя.

Забавно, что в западных источниках «Эйфорию» сравнивают даже с сериалом «Тюрьма Оз», причем критерием для сравнения выступает количество оголенных в кадре пенисов, а ведь в «Тюрьме Оз» были сцены с общими мужскими душевыми. «Эйфория» в этом смысле действительно прорывной проект даже для кабельного телеканала HBO, где чего только не показывали, но такого еще не было: впервые ради сцен с обнаженкой перестают объективировать женщин и принимаются за мужчин. Поэтому «Эйфория» с ее честным хронометражем серии в час, чего греха таить, подходящий фоновый сериал для того, чтобы заниматься под него (хим)сексом (употребление психоактивных веществ во время секса. — 

Esquire), причем подойдет он для этих грязных целей кому угодно с любой точки ЛГБТ-спектра.

Но не все так уж хорошо: вынуждены предупредить, что по ходу развития сюжета (HBO выдали критикам сразу полсезона) применяются классические методы растягивания нарратива. Типичная «Санта-Барбара»: долгие разборки, кто кого любит, а кто кого не очень, важных событий происходит все меньше, а четвертая серия — и вовсе один сплошной филлер, где единственная важная для зрителя встреча героев, которые до того лишь переписывались, не зная личностей друг друга, предваряется многочисленными комедийными и сексуализированными сценами. Впрочем, и дальше иногда можно найти шок-контент — например, вставная интерлюдия в виде целой лекции по дикпикам, да еще и стилизованная под древний учебный фильм, снятый на пленку: Зендая с указкой объясняет, что определить хороший дикпик несложно, для этого достаточно смотреть не только на сам член, а еще на ракурс и детали вокруг (например, на грязь в комнате на фоне и под ногтями). Хочется надеяться, что дальше революционно смелое содержание возьмет верх над привычными сериальными уловками.

Юлия Латынина об оправдании зла в современном обществе — Газета.Ru

Нобелевский лауреат Гюнтер Грасс написал вызвавшую изрядный шум стихостатью о будущей мировой войне, которую развяжет против Ирана государство Израиль, «ядерная держава, угрожающая и без того хрупкому миру на планете». Язык не поворачивается назвать это стихотворением, и по очень простой причине: стихи многозначны. Статья однозначна. Если человек написал стихотворение и все понимают, что он хотел сказать, — это плохое стихотворение. Если человек написал статью и все спорят, что он хотел сказать, – это плохая статья.

Гюнтер Грасс хотел сказать то, что сказал. Он сказал, черным по белому, что в грядущей мировой войне будет виноват не Иран.

То есть Иран, конечно, тоже виноват, но это несчастный народ, «вынужденный ликовать на демонстрациях и порабощенный хвастливым демагогом». В войне будет виноват Израиль, потому что он осмеливается бороться с Ираном. Давайте продолжим эту мысль.

Если террорист взрывает автобус с детьми, то виноват не террорист. Террорист – это бедный, несчастный человек, которому заморочили голову злые аятоллы и который живет в несчастной стране, обобранной проклятым Западом. Виноват проклятый Запад, который с террористом борется, вместо того чтобы помочь его неcчастьям.

Если вашу дочь изнасиловал и убил насильник, то виноват не насильник: он несчастная жертва обстоятельств, которую надо было вовремя распознать и лечить. Виноваты полицейские, которые почему-то провозгласили насилие и убийство преступлением, вместо того чтобы распознать эту тяжелую болезнь и подходить к ней как к болезни, над которой не властен болеющий.

Если ученик в классе пьет, нюхает клей и не учится, то виноват не ученик. У него тяжелое детство и психологические проблемы. Виноват учитель, который ставит ему двойки, вместо того чтобы помочь ученику проникнуться красотой науки.

Абсурд? Бред? На самом деле это стало стандартным политкорректным способом мышления в Европе. Диктатом общественного мнения.

Основным мифом леволиберальных СМИ и международной бюрократии. Преступник не тот, кто творит зло. Тот, кто творит зло, – он несчастный, непонятый; мы должны быть гуманны, договориться, разъяснить ему. Преступник — тот, кто со злом борется.

Лернейская гидра? Это исчезающе редкий вид, несчастное создание, для помощи которому нужно срочно организовать международную комиссию и получить финансирование от ООН. Собираем помощь от всех людей доброй воли под фондом «В помощь Лернейской гидре»! Геракл? Негодяй, которого нужно судить за неправомерное применение силы и уничтожение редких видов животных.

Медуза Горгона? Она пережила тяжелое детство, предки ее пострадали от греческого империализма. Тесей? Военный преступник.

Преувеличение? Отнюдь.

Леволиберальные СМИ и международная бюрократия активно пропагандируют сострадание и сожаление к изуверам, террористам, негодяям и просто дебилам. Что бы они ни делали – взрывали автобусы с детьми, грабили магазины во время лондонских беспорядков, создавали оружие массового уничтожения – всегда они оказываются бедные, несчастные, им надо помочь, и каждый гюнтер грасс нашего времени, заламывая руки, спрашивает — что мы можем сделать для них? Задавать вопрос «что должны они сделать для себя?» считается дурным тоном.

Такому положению дел есть несколько причин. Одна из них – историческая. Леволиберальная интеллигенция и правозащитные движения исторически происходят от «борцов за мир», «обличителей буржуазии» и прочих полезных идиотов, щедро финансируемых и используемых СССР. Эти люди именуют себя интеллектуальной элитой Запада, но еще с 30-х годов они научились полезному трюку — обличать ужасы буржуазной несвободы, в упор не замечая при этом сталинского ГУЛАГа.

Вторая – практическая. После кончины СССР леволиберальная идеология стала любимой идеологией международной бюрократии и парабюрократических организаций типа Amnesty International и Human Rights Watch, а принцип деятельности и тех и других очень прост: проблему не надо решать. Надо учредить комиссию и сделать так, чтобы проблема была вечной.

Третья причина заключается в том, что в современном мире война не окупается ни для кого, кроме людоедов вроде Конго, Судана или Ирана. И страны цивилизованные, естественно, имеют потребность в идеологии, которая объясняет, почему не надо воевать с несчастными людоедами.

А четвертая причина очень проста — это трусость. Трусам очень приятно чувствовать себя героями. Можно, конечно, воевать с террористами. Рубить Лернейскую гидру. Но ведь это опасно: террористы-то стреляют в ответ. Куда приятнее объявить террориста жертвой обстоятельств, затеять с ним переговоры, учредить комиссию, освоить деньги и восклицать, тыча в Геракла: «Этот негодяй нарушил права бедного, несчастного, нуждающегося в нашей помощи и понимании создания». Трусы переименовали героев в преступников, а себя – в защитников прав человека и «сторонников мирного разрешения конфликта».

Одно меня радует. Эта тоталитарная идеология, именующая себя «общечеловеческими ценностями» (все тоталитарные идеологии претендуют на то, чтобы быть «общечеловеческими»), еще, слава богу, не распространилась на кино и литературу.

Еще никто не снял кино про несчастного, нуждающегося в нашем внимании доктора Ноу, с которым борется кровавый Джеймс Бонд, и не написал книгу про обиженного в детстве сироту лорда Вольдеморта, которого без суда и без следствия убивает нехороший Гарри Поттер.

Сделать это – даже объединенными усилиями газеты Guardian, Human Rights Watch, Джулиана Ассанжа, Гюнтера Грасса и Махмуда Ахмадинеджада — будет трудновато, ибо эта тоталитарная идеология противоречит фундаментальному принципу человеческого общежития, который заключается в том, что зло должно быть наказано и что тот, кто с ним борется, – герой, а не преступник.

На ней могут опробовать механизм укрепления верховенства права

В ходе намеченного на сегодня заседания Еврокомиссии предстоит рассмотреть весьма деликатный вопрос: готов ли Евросоюз применить механизмы давления на Варшаву, после того как в Польше были приняты спорные поправки к законодательству о Конституционном суде и работе СМИ. Как предупредил один из еврокомиссаров, немец Гюнтер Эттингер, на встрече может быть решено задействовать в отношении Варшавы специальный механизм мониторинга соблюдения верховенства права, ранее никогда не использовавшийся в ЕС. Представители польских властей в ответ напомнили, что ранее Польша уже оказывалась под немецким надзором — во время Второй мировой войны.

В Брюсселе сегодня пройдет первое в новом году заседание Еврокомиссии — главного исполнительного органа ЕС. Накануне переговоров еврокомиссар по цифровой экономике и информационному обществу Гюнтер Эттингер (он представляет ФРГ) заявил газете Frankfurter Allgemeine Sonntagszeitung, что в отношении Варшавы (впервые в европейской практике) может быть задействован механизм укрепления верховенства права. Он был создан в 2014 году для борьбы с систематическими нарушениями принципа верховенства закона и включает в себя три стадии: оценку Еврокомиссией положения дел в стране, составление рекомендаций и мониторинг их соблюдения. Если эти меры не позволят исправить ситуацию, может быть начата процедура лишения государства права голоса в Евросоюзе.

Впрочем, представитель Еврокомиссии Кристиан Виганд вчера пояснил «Ъ», что говорить о принятом решении рано. «Предстоит политическая дискуссия»,— пояснил он, отметив, что пока санкций против Польши вводить не планируется.

Напомним, взаимное недовольство между Варшавой и ее западноевропейскими партнерами назревало еще с конца прошлого года, когда к власти в Польше вернулась партия «Право и справедливость» Ярослава Качиньского. Одним из первых решений нового премьера Беаты Шидло было убрать из зала заседаний правительства флаги ЕС. «Мы хотим вылечить нашу страну от нескольких болезней,— обозначил в начале января позицию властей новый глава МИД Польши Витольд Ващиковский.— Прежнее правительство реализовывало левую программу, как будто бы мир по марксистскому образцу должен развиваться только в одном направлении, к новой смеси культур и рас. Этот мир велосипедистов и вегетарианцев, пользующихся исключительно возобновляемыми источниками энергии и воюющий против любых проявлений религиозности, имеет мало общего с традиционными польскими ценностями».

Наиболее резкую критику западных партнеров вызвали два решения польских властей: поправки к закону о Конституционном суде, на практике ограничивающие полномочия этого органа, и к закону о СМИ, которые позволят правительству страны отправлять в отставку и назначать руководителей национальных телерадиовещательных компаний. Эти реформы вызвали шквал критики в ряде стран ЕС, прежде всего в Германии. Председатель Европарламента, политик из ФРГ Мартин Шульц, заявил, что Варшава проводит «опасную политику управляемой демократии в стиле Владимира Путина, опасную путинизацию европейской политики».

После заявлений господ Эттингера и Шульца в польский МИД был вызван посол ФРГ в Варшаве Рольф Никель. По словам министра юстиции Польши Збигнева Жебро, «такие слова из уст немецких политиков вызывают у поляков самые худшие ассоциации». «Я — внук польского офицера, который во время Второй мировой войны боролся с немецким надзором»,— пояснил он.

«Пока правительство сменило руководство гостелевидения и радио»,— рассказал «Ъ» шеф-редактор польской газеты Gazeta Wyborcza Роман Имельский. По его словам, в Варшаве ходят слухи и о проекте «большого закона», в соответствии с которым, в частности, произошли бы кардинальные кадровые изменения в Польском агентстве печати (ПАП). В ПАП «Ъ» не стали комментировать эту тему. «Одно можно сказать наверняка: новые власти сделают все, чтобы гостелевидение и радио не говорили ничего против правительства»,— уверен господин Имельский.

По мнению же директора Центра исследования демократии при варшавском Университете социальных и гуманитарных наук Радослава Марковского, Ярослав Качиньский «ошибочно пытается последовать примеру (также раскритикованного ЕС за инициирование спорных законов о реформировании национального законодательства.— «Ъ») венгерского премьера Виктора Орбана, заявлявшего, что «Евросоюз лает, но не кусает»». «Но любому терпению есть предел, и страны не могут бесконечно выступать с требованиями, идущими вразрез с принципами ЕС,— пояснил политолог «Ъ».— Кроме того, не в пример Венгрии, Польша — более значимый и влиятельный партнер по ЕС и НАТО для западных стран, поэтому действия Варшавы не могут остаться незамеченными, и реакция может оказаться куда жестче».

Галина Дудина


rgdb.ru — Эксперты РГДБ рекомендуют. 05.03.2021

На текущей неделе эксперты Российской государственной детской библиотеки составили новый список книг по запросам читателей в рамках сервиса «Индивидуальные рекомендации».

 

 

«Индивидуальные рекомендации» – это подбор книг сотрудниками РГДБ с учетом пожеланий родителей и интересов конкретного ребенка. Сегодня изданий для детей выходит достаточно много. Однако не всегда читатели могут самостоятельно разобраться во всем многообразии детской литературы и выбрать действительно хорошую книгу. В связи с этим многие родители хотят получить для своих детей персонализированный рекомендательный список для чтения.

В соответствии с предпочтениями читателей эксперты РГДБ подобрали произведения по темам, указанным в поступивших запросах.

 

Тема «И как это все устроено?»

 

  • «Вопросы памяти» (6+) Мишель Мира Пон
    В промозглый зимний день мы смотрим фотографии, сделанные летом, и снова слышим, как плещется волна и шуршит под ногами песок. Или проходим мимо кондитерской, от которой пахнет шоколадом и карамелью, и вспоминаем голос бабушки, которая пекла шоколадные кексы с карамелью к приходу гостей. Детские воспоминания остаются с нами навсегда, а какие-то знания забывается быстро. Где проходят дорожки памяти и как зарастают они? Есть ли память у растений и животных? Влияет ли на нашу память интернет-революция? Эта познавательная книга расскажет много интересного о памяти взрослым и детям.
  • «Отель «Головной мозг»» (6+) Мария Баселер
    «Твой мозг – пульт управления всем телом! Ему необходимы: тренировки, защита, отдых, пища», – заявляют авторы и художник прямо с обложки книги. И сразу становится понятно, что детей не придется заставлять читать эту книгу, они сами прочтут ее с удовольствием. Из этой книги можно узнать, отдыхает ли наш мозг, какая зона мозга «самая умная», почему не бывает «глупых вопросов», какая музыка полезна нашему мозгу и еще многое-многое другое.

  • «Профессор Астрокот и его путешествие по телу человека» (6+) Доминик Воллиман
    Профессор Астрокот и его друзья отправляются в путешествие по телу человека. Уменьшившись до небывалых размеров, герои исследуют внутренние органы: скелет, мышцы, кожу, рот, глаза, нос, уши, головной мозг, нервную и кровеносную системы, легкие, сердце, органы пищеварения, печень, почки, лимфатическую, иммунную и половую системы. Юные читатели узнают, что значит быть живым, какие виды клеток бывают, что такое «наследственность», как заботиться о здоровье и что делать, если твое тело отличается от других. А еще, как это любит Астрокот, поразмышляют о будущем и узнают множество интересных фактов. С помощью этой книги вы можете заглянуть внутрь каждого органа человеческого тела и прочитать, как он работает.

 

 

Тема «Звуки музыки»

 

  • «Как слушать музыку» (6+) Ляля Кандаурова
    Музыка – такая естественная, органичная человеку, интуитивно понятная вещь. Разве тут нужны какие-то правила? Музыка воспринимается как нечто стихийное, воздействующее на чувства помимо рассудка и анализа. «Если не отзывается, значит, не моё, вот и все», – таково обыденное рассуждение. Автор этой книги – известный музыкальный журналист и лектор-популяризатор – утверждает, что так мы лишаемся огромного количества красоты. Доступная и близкая музыка, для прослушивания которой не нужны специальные навыки, – это всего лишь снежная шапка на вершине айсберга. Для постижения всего остального музыкального богатства нужен навигатор. С помощью этой книги можно слушать и учиться понимать любую «умную» музыку – содержательную, глубокую, необычную, будь то произведения академические или современные: джаз, электроника, рок, фолк или даже рэп.
  • «Уроки музыки. Все о музыкальных инструментах. Нотная азбука» (6+) Наталья Кончаловская, Петр Синявский
    Для того чтобы научиться играть на музыкальных инструментах, нужно знать ноты. В алфавите тридцать две буквы, а сколько нот в нотной азбуке и как найти их на клавишах, – маленький читатель узнает из этой книги. А еще научится играть левой и правой рукой вместе, познакомится с разными музыкальными инструментами и сам не заметит, как освоит музыкальную азбуку.
  • «Приключения ДоРеМишек, или Музыкальный огород: изучаем ноты» (0+) Виктория Иващук
    Это книжка на самом деле поможет ребенку запомнить ноты, только открыть ее придется не раз и не два. Сначала нужно прочесть книгу вместе с ребенком, потом наклеить наклейки, начать играть ноты на инструменте и петь вместе с ребенком. Также рекомендуется нарисовать нотный стан на бумаге, а на него прилепить пластилиновые «овощи»-ноты. Любимая нота зеленой ДоРеРешки называется до-диез или ре-бемоль в зависимости от желания композитора. Ноту красной МиРеМишки зовут ре-диез или ми-бемоль. Фиолетовая ФаСольФашка называет свою ноту фа-диез или соль-бемоль. Оранжевая СоЛяСолька – соль-диез или ля-бемоль. Синяя СиЛяСишка – ля-диез или си-бемоль. И все это необыкновенно интересно!

 

 

Тема «Изучаем историю России»

 

  • «Наша эра: история России в картах» (6+) Тамара Эйдельман
    В этой книге двенадцать веков истории России уместились в несколько десятков страниц – но каких страниц! Из лаконичных, но удивительно емких и информативных текстов читатель узнает обо всех основных событиях, политических течениях и настроениях разных эпох, о выдающихся деятелях политики, науки и искусства и даже о том, что в это время происходило в соседних странах и как это отражалось на жизни россиян. Не менее значительный вклад в содержание сделала художница Анна Ритум, нарисовавшая к каждой странице «говорящие» карты. На них не только нанесены границы и названия государств и племен, но и отмечены важнейшие исторические события, направления торговых путей и военных походов, основные занятия населения, выдающиеся личности эпохи и научные открытия.
  • «Как жили в Древней Руси» (6+) Ольга Колпакова
    Как жили в Древней Руси: где жили, что ели, как одевались, чему учились, куда ездили, какие праздники праздновали, с кем воевали, чем лечились? И откуда мы знаем обо всём этом? На каком языке писали и говорили древнерусские люди? Сильно ли этот язык отличался от русского современного? Как и в других книгах этого издательства, здесь очень много иллюстраций: репродукций картин русских художников (В. и А. Васнецовых, К. и В. Маковских, Б. Кустодиева), рисунков И. Билибина и Е. Бём. В каждой главе приводятся пословицы и поговорки. Текст и иллюстрации можно использовать для занятий с детьми.
  • «Жизнь русского города : от древнего поселения до современного мегаполиса» (0+) Марина Яуре
    Как строили первые города древние славяне, как добывали пропитание (земледелием, скотоводством, охотой), как развивались ремёсла и зарождались сословия, как Русь приняла крещение, как томилась под татаро-монгольским игом, как поднималась, крепла под властью московских князей, как возникла новая столица – Петербург, как преобразились русские города в ХХ веке… И всё это наглядно показано на красочных разворотах с лаконичным и ёмким информативным текстом. Разглядывая страницы этой книги, читатель испытывает не только интерес, но и чувство причастности к русской истории, симпатию и сочувствие к людям, изображённым на иллюстрациях. Как увлекательно рассматривать, например, богатый дворянский дом, где в каждой комнате кипит жизнь: в одной – партия в вист, в другой лакеи накрывают на стол, в детской няня играет с малышами, на кухне готовится пирог, в девичьей девушки сидят за прялкой, а в ярко освещённом зале вальсируют пары… Новая эпоха – новые реалии. Художник рисует, а автор поясняет, что такое стиль модерн, ночлежный дом, электростанция, коммуналка, пионеры, квартирный концерт певца-барда, банкомат, солнечные батареи, коворкинг…

 

 

Тема «Хочу все знать!»

 

  • «История шифров» (0+) Виктория Журавлева
    В этой книге рассказывается о сложной науке криптографии – умении зашифровать свое послание так, чтобы оно было доступно только тем, кто владеет ключом к шифру. Любознательный читатель узнает разновидностях шифров и тайных языков, о том, что шифры можно встретить не только в переписке разведчиков, но и в… обыкновенном с виду стихотворении, и называется такая литературная головоломка – акростих. А также о том, что шифры используют не только шпионы, но и банкиры, айтишники, дипломаты. Внимательно прочитав эту книгу, вы сможете смастерить собственную «скиталу», с помощью которой зашифровывали свои послания жители древней Спарты, шифровальный диск Леона Альберти или решетку-трафарет для дипломатической переписки, вроде той, которой пользовались кардинал Ришелье и автор «Горя от ума», а по совместительству руководитель русской дипломатической миссии Александр Сергеевич Грибоедов.
  • «Куда летит летучая мышь?» (0+) Фридерун Райхенштеттер
    Серия познавательных историй немецкой писательницы Фридерун Райхенштеттер с рисунками художника Ханса-Гюнтера Дёринга очаровывает маленького читателя с первого же взгляда на обложку книги. Коротенькая история рождения и взросления летучего мышонка сопровождается рассказами о разновидностях летучих мышей и их особенностях. Очень ясно, точно и доступно в книге объясняется, где водятся эти зверьки, чем они питаются, как спят, как работают их мышцы и как устроены крылья, что такое биолокация, кто им угрожает и полезны ли они для людей (спойлер: очень полезны, потому что ловят насекомых). Замечательное научно-популярное издание увлекательно и достаточно подробно рассказывает маленьким читателям об этих удивительных созданиях.
  • «Микро. Тайны невидимого мира» (0+) Никола Дэвис
    Книга о самых крошечных существах на планете – на усике муравья их поместится целый миллион. Английская писательница и учёный описывает микробов и их жизнь очень лаконично, не перегружая информацией, точно и красочно. Именно так, как и нужно самым маленьким читателям. Из книги они узнают самое главное о микробах – что они очень маленькие, что их много и они очень разные, что они бывают полезными и вредными. От вредных можно заболеть, а полезные делают кучу дел, которые без них никто не сделает. Например, йогурт. Никола Дэвис пишет нон-фикшн книги для детей, которые попадают в шорт-листы многих литературных премий, и ведёт программы на радио Би-Би-Си для детей о дикой природе.

 

 

Для того чтобы воспользоваться сервисом «Индивидуальные рекомендации», необходимо отправить письмо на электронный адрес Адрес электронной почты защищен от спам-ботов. Для просмотра адреса в вашем браузере должен быть включен Javascript. с пометкой «Рекомендация». В письме следует указать тему заказа, любимые жанры и читательские предпочтения.

Например: «Книги про кошек для девочки семи лет, которая любит добрые и веселые фантастические истории современных авторов».

В письме также необходимо указать фамилию, имя и отчество читателя, дату рождения, 4 последних знака 24-значного кода, расположенного на обратной стороне читательского билета или идентификатор, полученный в письме с подтверждением предварительной регистрации.

Сотрудники отдела рекомендательной библиографии РГДБ подготовят список книг, из которого читатель сможет выбрать интересующие его издания и оформить электронный заказ.

Заявки принимаются и обрабатываются в будние дни. Срок выполнения заказа – 5 рабочих дней. Отобранные книги хранятся в зоне регистрации на первом этаже в течение 3-х рабочих дней.

 

 

 

Информация о материале
Категория: Эксперты РГДБ рекомендуют

Сорвиголова Кик Бутовски — это… Что такое Сорвиголова Кик Бутовски?

Сорвиголова Кик Бутовски
Kick Buttowski: Suburban Daredevil

Официальный русский логотип
Жанр

Мультфильм
Комедия

Автор(ы)

Сандро Корсаро

Режиссёр(ы)

Крис Савино
Шерм Коэн

Сценарист(ы)

Дерек Дресслер
Карл Фаруоло
Клэй Морроу
Дэвид Шэйн
Сандро Марио Корсаро

Производство

Disney XD Original Productions, Walt Disney Television Animation

В главных ролях

Чарли Шлэттер
Мэтт Л. Джонс
Дэнни Кукси

Композитор

Энди Стёрмер

Страна производства

 США

Язык

Английский

Количество сезонов

2

Количество выпусков

52 (Список эпизодов)

Производство
Продюсер(ы)

Сандро Корсаро
Крис Савино
Janelle Momary

Исполнительный продюсер(ы)

Сандро Корсаро
Крис Савино

Продолжительность

22 минуты

Вещание
Телеканал(ы)

Disney XD
Канал Disney (Россия)

Формат изображения

1080i (16:9) (HDTV)

Формат звука

Dolby Digital 5.1

Период трансляции

С 13 февраля 2010 года по сегодняшний день

Ссылки
Официальный веб-сайт
Страница в IMDb

Сорвиголова Кик Бутовски (англ. Kick Buttowski: Suburban Daredevil) — американский мультсериал, производится и принадлежит The Walt Disney Company. Правами на показ сериала в России обладает канал Disney Channel Russia. Российская премьера этого мультсериала состоялась 1 ноября 2010 года.

Сюжет

Файл:Сорвиголова и Гюнтер.JPG

300px

Весь сериал крутится вокруг мальчика по имени Кик Бутовски. У него есть хобби — он обожает экстрим. Во всех его делах ему помогает его друг — толстячок Гюнтер. Так же ему приходится разбираться со своим старшим братом Брэдом и младшей сестрой Брианной.

Кик — великий борец с обыденностью, который стремится сделать каждое мгновение своей жизни особенным. Твердо решив стать самым отчаянным каскадером в мире, Кик понимает, что ему необходимо преодолеть все жизненные обстоятельства на этом пути. В этом ему помогают его верный скейтборд «Синий», велосипед «Пила» и самокат.

Персонажи

Кларенс Фрэнсис «Кик» Бутовски

Главный герой сериала, любитель острых и опасных ощущений. Он ненавидит Кенделл.

Ему 13 лет. Его основная цель жизни — каждый день совершать какой-нибудь опасный трюк. Он довольно мал ростом. Носит белый комбинезон с красными полосами на рукавах, белый шлем с красной полосой, желтые ботинки и перчатки. Некоторые из его любимых фраз: «Ты не нравишься мне, а я тебе», «Чимичанга» и «Ай, крышка». Способен развивать огромную скорость, хотя на стадионе пробежал дистанцию 400 м на 30 секунд медленнее остальных ребят. Является вторым ребёнком в своей семье. Очень часто ссорится с Брэдом и иногда с Брианной. Дружит с Гюнтером. Его день рождения 22 февраля. Цвет волос каштановый. Имеет рыбку по имени Стив.
  • Гюнтер Магнусон — толстячок, лучший друг Кика. Всячески помогает ему с трюками, однако сам немного трусоват. Кик способен рисковать ради друга чем угодно, в одной серии даже подставлял себя под укусы аллигаторов, чтобы те не тронули спящего Гюнтера. Ему 12 лет, хотя он выше Кика. Гюнтер носит голубые шорты, рубашку с красной кепкой и оранжевые сандалии. По происхождению норвежец. Иногда проявляет высокую физическую силу, умеет хорошо маскироваться. Любимая фраза «Мне это не нравится». Когда он злой, то может петь песни в стиле рэп. Родился 6 июня. Очень добрый и весёлый. Его родители викинги.
  • Брэдли Фрэнсис «Бред» Бутовски — старший брат Кика и главный антагонист сериала.Наглый. Ему 15 лет. Любит издеваться над Киком. Остаётся за старшего, когда родителей нет дома. У Бреда плохо с личной гигиеной. Ужасно учится. Считает, что пользуется популярностью. Часто называет Кика «Дурила». Коллекционирует прожёванные черлидерами жвачки. Любит общение с девушками (часто становится причиной нового сюжета). Его день рождения 14 мая.
  • Луиджи Вендетта — итальянский мальчик и самый младший из семи итальянских братьев. Умеет петь мужским голосом. В серии «Луиджи Вендетта» извёл Брэда песней «Старший не должен младшего терзать», чтобы он не издевался над Киком (не сработало). 13 лет.
  • Брианна Фрэнсис «Бри» Бутовски — младшая сестра Кика. Ей 9 лет, хотя она одного с Киком роста. Очень часто участвует в конкурсах красоты. Избалованная. Так как Брианна очень молода, то получает желаемое с помощью фразы «Я хочу…» и очень громкого крика. Любит раздражать Кика, но в отличие от Брэда (которого тоже не любит) уважает его и даже ведёт себя как он. Является поклонницей Тины Иногда, одеваясь как она. Любит единорогов и пони, как все маленькие девочки. Имеет соперницу, Пенелопу Патерсон. Часто издевается над Киком, однако не позволяет никому другому делать это. Член клуба «Манерные крошки». Из-за своей вспыльчивости вступила в него только со 2 раза с помощью Кика.
  • «Уэйд» Уэйд Т.Смиттерс — работник в магазине «Еда и ремонт», друг Кика и Гюнтера. Носит шапку, которая закрывает глаза. Всегда готов помочь друзьям, особенно если дело касается трюков. Называет Кика с Гюнтером — человек опасность и северный амиго. Очень любит свой сокс. 27 лет.
  • Кендалл Перкинс — вредная и строгая староста класса в котором учатся Кик и Гюнтер. Любит Кика, хотя строит вид, что просто ненавидит до глубины души. Доказательством является надпись на шкафчике «Я люблю Кика Бутовски», желание поцеловать его на школьном спектакле Ромео и Джульетта. Встречается с Рональдо. Её день рождения 8 марта. 12 лет.
  • Билли Стампс — всемирно известный экстремальный смельчак. Кик является его ярым фанатом, и готов пойти на что угодно ради встречи с ним или получение связанных с ним предметов (у Кика есть книга с его автографом, которой он дорожит). У него отсутствует рука (именно поэтому его называют «Стампс»), и неизвестно, почему (по-видимому от одного из своих трюков). Вполне возможно, что он родился без рук, как в воспоминаниях (от 1982) он до сих пор была только одна рука. Чаще всего появляется на плакате в комнате Кика или связанной с ним продукции. 50 лет.
  • Джеки Вакерман — безумная одноклассница Кика. Она так же является его фанаткой, причём иногда она бывает даже слишком фанатична. Это часто мешает Кику. В одной из серий влюбила в себя Гюнтера, из-за чего тот покорил Вдовий Пик. 13 лет.
  • Скарлет Розетти — девочка-каскадёр, дублёр Тины Иногда. Своими трюками пленила сердце Кика. Кик помог ей открыть себя. Когда она ушла из шоу, Кик занял её место. Именно благодаря этому её сделали антагонистом шоу «Тина Иногда». 12 лет.
  • Хани Бутовски — мама Кика. Она очень заботливая и всегда защищает Кика, хотя она часто беспокоится о нём, но зачастую помогает ему в его трюках. В серии «Клёвые гены» выясняется, что она когда-то была известным смельчаком в гонках на скоростных катерах, под псевдонимом «Хани Всплеск». В той же серии показывается, что Хани подарила первый комбинезон Кику, что бы подбодрить Кика в его начинаниях сорвиголовы. 36 лет.
  • Гарольд «Гарри» Бутовски — отец Кика. Он, как правило, весёлый и спокойный, но в то же время предельно нервный и осторожный. Испытывает нездоровую любовь к своей машине (1979 AMC Pacer Wagen), называя её Моник (у его жены похожая ситуация со своей машиной по имени Антонио). Любит бумажную работу со счетами и письмами, является королём Пинг-Понга. 40 лет.
  • Рональдо — злобный физик класса где учатся Кик и Гюнтер. Влюблён в Кендалл, но в отличие от неё ненавидит Кика по-настоящему. Также известен под именем «Тёмный субъект». 12 лет.
  • Магнус и Хельга Магнусон — родители Гюнтера. Владеют местным рестораном «Боевые закуски». Викинги. По происхождению норвежцы. Ровеснки Гарольда и Хани.
  • Бьёрген — дядя Гюнтера и брат Магнуса, также работающий в ресторане «Боевые закуски». Часто произносит слова рифмующиеся с его именем. Например: Oрген-Морген-Йорген-Бьёрген. Норвежец. 39 лет.
  • Мистер Викл — сосед семьи Бутовски. Упитанный, милый холостяк с женственной личностью. Редкий взрослый которого не раздражают трюки Кика. 47 лет.
  • Пэнтси — один из друзей Брэда. Он также является заместителем руководителя кинотеатра Меллоубрука, и имеет очень жесткую политику, когда дело доходит до клиентов. Обычно носит 3D очки. Имеет младшего брата. 15 лет.
  • Гораций — другой друг Брэда. У него зеленые волосы, закрывающие лицо. 15 лет.
  • Миссис Фицпатрик — учительница Кика в начальной школе Меллоубрука. Её любимая фраза «Угуу…». Надпись «Хмм…» является номерным знаком её автомобиля. 51 год.
  • Пенелопа Патерсон — ровесница и соперница Брианны. Носит чёрные волосы и зелёные глаза. Умеет ездить на одноколёсном велосипеде и читать одновременно отрывки произведений Шекспира. Исключена из клуба «Манерные крошки», сразу после того, как Бриану туда зачислили. Ей 9 лет.
  • Мисс Чикарелли — соседка семьи Бутовски. Стервозная, ненормальная, престарелая госпожа, сплетница, всячески пытающаяся навредить всем окружающим.В прошлом была учителем дисциплины. 64 года.
  • Оскар Чикарелли — пес Мисс Чикарелли, удивительно похожий на свою хозяйку: такой же злой и невоспитанный, но со своей хозяйкой ведёт себя крайне учтиво. Поведение Оскара и поведение Кика идентичны, что проявляется в серии «Пропала собака!».
  • Мертвец Дейв — легенда скейтбординга как говорит Кик. Все считают что он умер во врямя трюка, но о том что он живой знают только Кик и Гюнтер. Живёт в заброшеном парке развлечений. Его показывали только в двух сериях из всего мультисериала.
  • Рок Калахан — киноактер и кинокаскадер. Кик — его фанат (имеет часы, на которых ихображен Рок Калахан). 41 год.Снялся в фильмах Оптокоп и Персей в Питцбурге
  • Билл Гринн (Мистер Гринн) — скейтбордист, на скейтборде у него написано Mr.Greenn. 36 лет
  • Диктатор Бутовски — дедушка Кика. Во время войны был разведчиком. Поведение похоже на поведение персонажей современного мира Кика, на это показывает представление Кика во время его рассказа о миссии, на которой был его дедушка. 62 года.
  • Майк-Грязный Байк — ещё один любимый кумир. Носит перчатки со словами «отчаянный парень». Костюмом, шлёмом и байком похож на банку «Пыхтения гепарда». Вспоминался в серии «Незащищённый» и в серии про мёртвую петлю как не сумевший её покорить от гравитации. 37 лет.
  • Бум МакКондор — четвёртый кумир Кика. Худой высокий блондин. Носит джинсы, чёрную кофту и белые сапоги. Любимая фраза: «Кар-кар!» С помощью горных орлов способен летать. Каскадёр.Имеет счастливое колесо от скейтборда . В серии «Things That Make You Go Boom!» Кик соревновался с Брэдом, за право сделать трюк вместе с Бумом на Гавайях. 38 лет.

Кайл Бутовски

Кузен Кика, всё время его раздражает и всегда меняет тему разговора, а также говорит то, что не связано со случаем. Почти все в Мэллоубруке его враги (потому что он их раздражает). 10 лет.

Библиотекарша

Вспыльчивая и невыносимая библиотекарша Мэллоубрукской библиотеки. Из её библиотеки невозможно вернуть, что однажды там оставил. По словам Гюнтера, она настоящее зло, хотя выглядит, как милая бабушка, заплетает две косички. Носит длинную зелёную юбку с чёрными пуговицами и кофту песчаного цвета. 59 лет.

«Даррен» Дарентцо Керритцо-Ройза Раммирес

Создатель спортивной команды под названием «DLAmerican», которую он назвал в честь себя. Родом из Польши. 44 года.

Глен

Продавец в Мэллоубрукском торговом центре. Имеет личные счёты с Брианной. 39 лет.

Рози

Бабушка Кика и мама Гарольда. Она — Мастер Розыгрышей. Если её разыграть, то она отыграется. Много общего имеет с Киком, они оба обожают передачу «Хищные птицы Джока Уалдера».

Чак Гларман

Мужчина в очках, зацикленный на чистоте после того, как его грязный дом снесли и построили на его месте шоссе. Появился в серии «Сказание о мусоре». 40 лет

  • Род-Настоящее имя Кристофер,брат Пэнтси.Род может достать что угодно.

В ролях

Главные роли

  • Чарли Шлэттер — Кик Бутовски
  • Мэтт Л. Джонс — Гюнтер Магнусон
  • Дэнни Кукси — Брэд Бутовски
  • Ричард Дирк — Магнус Магнусон

Второстепенные роли

  • Джон Ди Маджио
  • Брайан Степанек
  • Кэри Уолгрен
  • Грей ДеЛайл
  • Эрик Кристиан Олсен
  • Мария Бэмфорд
  • Эмили Осмент
  • Ричард Стивен Хорвитз
  • Джефф Беннетт
  • Клэнси Браун
  • Саймон Хелберг
  • Роз Райан

Русский дубляж

Мультсериал полностью дублирован и был показан на телеканале Disney Channel Russia.

Интересные факты

  • Бриана очень похожа на актрису Тину (Тину Иногда).
  • У каждого члена семьи разный цвет волос: У Хани рыжие, у Брэда чёрные, а Брианна — блондинка. Лишь у Гарольда и Кика цвет одинаковый — каштановый
  • Учительница Кика Бутовски — мисс Фитцпатрик — имеет такую же фамилию как у Мэдди (Эшли Тисдейл) в сериале «Всё тип-топ или жизнь Зака и Коди».
  • Судя по фамилии Бутовски, можно полагать, что эта семья родом из Чехии.
  • Брианна похожа на Сьюзи из мультсериала «Финес и Ферб». Но в отличие от неё она мила со всеми кроме братьев, а не наоборот.
  • До получения костюма Кик носил джинсы и жёлтую футболку.
  • Семья Магнусон — викинги
  • В серии «История ябеды» указан вес Кика — 23 килограмма. А в серии «Утренняя спешка» когда они с Гюнтером висят на языке пятнистой лягушки, то он произносит: «Она выдерживает килограммов девяносто!». Значит вес Гюнтера чуть меньше 67 килограмм.
  • В шестой серии второго сезона телеигра «Вниз лицом» немного напоминает российскую телеигру «Жестокие игры»
  • Соперничество между Пенелопой Патерсон и Брианой напоминает соперничество Клер Брюстер и Лидии Дич в мультфильме Битлджус
  • Дедушка Кика в молодости был очень похож на него.
  • Мультсериал дважды номинировался на премию «Эмми» (в 2010 и 2011) и на премию Энни (в 2012)
  • Один из учеников школы,где учится Кик похож на Шелтона Клацбери из мультисериала «На замену». Так-же ещё один мальчик из «Кика Бутовски» похож на Джекобо Джекобо.
  • У Гюнтера на спине татуировка в виде плана собачьей тюрьмы (серия «Пропала собака!»).
  • Отец кика сильно похож на отца Купа из сериала «KID VS KAT»

Ссылки

Шаблон:Программная сетка телеканала Disney Channel Russia

Дело нескольких минут текст песни 3 round 17ib

Несколько минут назад я трахал суку в Мэрсе
Я слышал твои треки, это просто мерзость
Потратил несколько минут на твой рэп
Если ты — Саша FRG, тогда я - Гюнтер РФ
Ты не горчица с хот-дога, но ты был на SaSiSе
И на других онлайнах,  но так и не научился диссить
Мне сказали, что ты ветеран, видимо, пранк
Тебя обидеть можно фразой «О нем слышу первый раз»
Этого Сашу FRG чтоб разъебать наверняка
Закинулся Серым PLC, дунул Джамала TGK
И баттлить в таком режиме буду фразами Хайда
«Типа как три большие буквы? Оригинально, правда? «
FRG — это аббревиатура, в ней скрыто
Тупое слово «Forgotten», что в переводе «забытый»
Ну как вы яхту назовете, так она и поплывет
Только вот тебя и так не вспоминали, долбоеб!
Твой трек на второй раунд был о тайнах бытия
Полный нелепого экзистенциального нытья
Там человечество как вид приближается к коллапсу
Мы песчинки в масштабах космоса, да ты филасаф
И в процессе Саня перед Гагариным извиняется:
«Юра, прости, ведь нам не разгадать Солярис»
И вроде бы все ясно, вопросов, как видишь, нету
Как мы сможем разгадать вымышленную планету, блять?
Ты тупой, Саша, и любой скажет
Что ты вроде ебашишь, да только ты не пой, Саша
Ведь отрыжка не тенор, ты как барыга аптекой
Только на лирику твою никто не будет подсажен
FRG, имей хоть черный пояс, КМС
После баттла тебе нужен будет полис ДМС
Твоя лирика, диссы — говно различных оттенков
О политических треках сейчас поговорим отдельно
Ибо Павлов Александр работает в «Коммерсанте»
На посту секретаря, пруфы находятся на сайте
Так что, если про политику затирать будешь заново
Напомню, что ты пашешь на Алишера Усманова!
Того самого, чей дом снимали ФБК
Который с Сечиным отжал тогда у Дурова ВК
А ты читаешь о протестах, про Миллера и Сечина
Свободу слова, сука, ты придурок или как?
Ты подумай, представитель газеты олигарха
Пытается косить усердно под либераху
Говорит, что в соцсети тут за репост посадят
Но у тебя и соцсети один и тот же хозяин!
И в первом раунде типа включил иронию, по сути
«Я ебашу в долгий путь, прямо как Вова Путин»
Кремлебот ебаный, что натолкнуло на это?
Начальник видно приказал упомянуть президента
Итак, анализ твоих текстов показал, что наверняка
Ты с ними себя не ассоциируешь никак
Это куски чужих высказываний, плюс хуево спаянных
Логичней их сдавать тебе только на конкурс каверов
И даже твой никнейм сегодня тупо примитивен
Впрочем, как и виртуала, ведь не смог придумать имя
И тебе, имея закостенелый скелет
Нагнать сегодняшний рэп — дело нескольких лет
Ты не баттл-мс, мы давим с разной силой
Тебя, как новую обувь, стараюсь разносить
Покуда ты кряхтишь у майка над раскрытием темы
Я убиваю тени прошлого, как ассассин, ведь я
Тебя уважаю, прямо как Техник старину, да и
Пиздец ты парень нудный, на треках не раз зевнул
Признаю честно я вину, на тебя время убивал так
Что в итоге прохожу по делу нескольких минут

Че это мы такие серьезные? Между прочим, это не просто трек
Это фит! С человеком, который думает, что именно так фиты и делаются
Встречайте! Оксимирон!
«Пунктир — это ахуительно
Саня — ты самое слабое звено
Тебя вынести
Дело нескольких минут»

Я нож в живот не воткнул
Но на баттле нарезал пуп!

Понравился текст песни?
Оставьте комментарий ниже

О компании и контакты — Мэтт Гюнтер

Мэтт всегда ищет что-то уникальное и вдохновляется вызовом.

Как пожизненный житель Нью-Йорка, он видел многие сложности жизни человека. Он влюбился в управление повествованием, рассказывая историю с помощью картинок, от жесткости и привилегий западного центрального парка. От Майка Тайсона до Анджелины Джоли, от скейтбордистов до рэп-исполнителей, Мэтт смог найти острые углы и интимность в своих предметах и ​​сформировать их для всеобщего обозрения.Разоблачение этих скрытых повествований соответствовало его естественной чувствительности. И он видел истории во всех формах визуализации. Независимо от того, работает ли он задиристом с полицейским отделом, занимающимся разрушающейся средой, вооруженным громоздкой камерой 8 × 10 или снимающим фотоснимки и анимационную кампанию профессиональных спортсменов … Мэтт приспосабливается к среде, которая заставляет историю петь.

Первая монография Мэтта, Probable Cause , была опубликована Шилтом в 2016 году. Его работы являются частью постоянных коллекций Бруклинского музея и Дворца Токио в Париже и были представлены в журналах American Photography, PDN, Communication Искусство и др.

И когда он не снимает что-то, не собирает коллекции работ или не проводит время со своим сыном, Мэтт, вероятно, возвращает его обратно, прямо здесь, в Нью-Йорке, — читает лекции по фотографии в Pratt или Школе визуальных искусств.

Вот лишь некоторые из клиентов + партнеров Мэтта

Nike, Reebok, Adidas, American Express, MSNBC, FILA, AT&T, Verizon, Toyota, ARMY, Harvard Business School, Apple, BBH, McGarryBowen, Chase , Nowness, Gentlemen’s Quarterly, ESPN, NYTimes Magazine, Taylormade, WSJ, BMW, Fallon, Wieden & Kennedy и многие другие.


ВЫСТАВКИ

2015: Вероятная причина, Kimmel Gallery NYU
2011: Руководство коллекционера по новой художественной фотографии, Chelsea Arts
2001: Это Нью-Йорк, NY
2001: Prizefighters: «Это работа. »IKON Gallery, LA

КОЛЛЕКЦИИ

2004: Бруклинский музей, постоянная коллекция

ВЫБРАННО БИБЛИОГРАФИЯ
2021 — Пандемическая жизнь в американской фотографии
2020 — Люси летом в Нью-Йорке фильм
an 2018: WPA crushf Форум фотографии
2015-2016 Избранные работы
2016: Вероятная причина
2015: Communication Arts-CA Awards:
2014: New Yorker Magazine
2014: Тюремная фотография
2014: Featureshoot
2011: The Collector’s Guide to New Art Photography Vol.2, Chelsea Arts

2008; Big Bang

UCM — Гюнтер полагается на RAP для создания качественных смесей — Rock Road Recycle

Мэри Уивер

фото Уильяма Уивера

Дэйв Налл, менеджер по контролю качества асфальтовой стороны завода по переработке асфальта и бетона в Галесбурге, штат Иллинойс, Гюнтер, подразделение United Contractors Midwest (UCM), повесил на стене своего офиса знак: «Контроль качества всегда стоит меньше, чем Удалить-Заменить.Налл и остальная часть его команды твердо верят в это заявление.

Для Nall контроль качества включает в себя много этапов. «Мы разрабатываем собственные миксы», — пояснил он. Примерно 20 лет назад весь контроль качества выполнял штат Иллинойс. С тех пор подрядчики несут ответственность за контроль качества в своей компании. Это дает компаниям больше свободы в поиске и использовании менее дорогих материалов. Все материалы, используемые на заводе, поступают из штата, за исключением небольшого количества материалов, которые поступают через реку в Айове.«Мы не привязаны к конкретному поставщику», — сказал он.

«Первым шагом в контроле качества является проверка градаций материала, который мы получаем из карьеров, чтобы убедиться, что это те же градации, которые мы использовали при первоначальной разработке смеси», — продолжил Налл. «Мы проверяем градации с помощью набора маленьких экранов и небольшого вибратора. Наш заполнитель в основном состоит из доломита и имеет размер от дюйма до крупных 3/8 дюйма. Основная проблема, которую мы обнаруживаем, — это слишком много «штрафов» в совокупной совокупности.Все карьеры проходят контроль качества, поэтому в 9 случаях из 10 они соответствуют требованиям ».

Типичная конструкция может состоять из 60% заполнителя, 35% песка и переработанного асфальта (процент этого зависит от смесей) и 5% масла.

Recycling требует мощной дробилки, и они делают это на месте. «Наша основная машина — это ударная дробилка JW Jones. Эта машина на протяжении многих лет подвергалась суровым испытаниям, дробя и асфальт, и цемент, и продолжает работать ».

Поскольку очистка ударного элемента занимает много времени при замене материалов с бетона на асфальт и обратно, для измельчения асфальта используется Prosizer, чтобы избежать простоев при очистке дробилки.Из дробилки переработанный асфальт подается на грохот встряхивателя для его калибровки.

Технический песок является предпочтительным видом песка на заводе в Галесбурге. Камень дробится на песок, а не на природный песок. «Промышленный песок угловатый, а не округлый, как природный песок. Для асфальта очень важна угловатость. Кусочки угловатой формы сцепляются друг с другом и держатся на месте лучше, чем круглые песчинки ».

Масло — единственный ингредиент асфальтобетонной смеси, который не тестируется на заводе.«Мы не тестируем его, потому что у нас нет подходящего лабораторного оборудования. Образцы асфальтобетона берутся из наших резервуаров для хранения и отправляются в IDOT для тестирования ».

«В Иллинойсе, чтобы свести к минимуму растрескивание дорожного асфальта в экстремальных погодных условиях, мы используем масло с синтетическими полимерными присадками, которые придают смеси большую эластичность. Можно использовать несколько различных полимеров, в зависимости от средних и низких температур в той области, где будет применяться асфальт. Полимерные добавки будут отличаться, например, в северном Иллинойсе от тех, что используются в южном Иллинойсе.Мы можем получить резкие перепады температур. Летом асфальт действительно поглощает солнечное тепло, а зимой температура может резко упасть. Эластичность, которую синтетические полимерные добавки придают маслу, чтобы сделать его более пластичным, очень полезна в этих условиях.

Хотя каждая компания разрабатывает собственные асфальтовые смеси, штат Иллинойс проверяет результаты. «IDOT тестирует не менее 20% наших образцов. Когда мы берем образец, мы разделяем его пополам. Проверяем одну половину, а вторую половину сохраняем для состояния.У нас есть параметры того, насколько наши результаты должны быть близки к результатам штата, иначе это поднимет красный флаг.

«На практике мы часто отбираем от 2 до 4 раз в день, чтобы убедиться, что мы получаем нужные результаты. Если результаты хорошие, мы продолжаем использовать этот микс. Но это как в жизни. Не каждый раз будет идеально. Когда мы сталкиваемся с проблемами, мы вносим коррективы по ходу дела. Нас учили выявлять проблемы и предотвращать их ».

«Наша самая распространенная проблема — это слишком много штрафов.Если мы этого не исправим, через несколько лет это обычно приводит к образованию колей в дорожном полотне. В результате износа шин образуется траншея, в которую во время дождя будет собираться вода. Это может привести к аквапланированию ».

«Если мы сталкиваемся с действительно серьезными проблемами, мы выключаемся на день и продолжаем устранять неполадки, но в 90% случаев все, что нам нужно сделать, — это внести незначительные изменения в смесь. Иногда градации неожиданно меняются. Однако в большинстве случаев мы можем отрегулировать, добавляя разные материалы.

«Наши асфальтовые заводы компьютеризированы и настроены на добавление определенного процента каждого материала. Первое, что мы делаем, когда готовимся к запуску каждый апрель, — это калибруем растение, поэтому, когда мы программируем его на добавление 15% данного ингредиента, оно фактически будет вводить 15%. Калибруем раз в год. (Завод закрывается на зиму в конце ноября.) В большинстве случаев откалиброванный завод «мертв на деньги».

«Проблемы с компьютерной системой случаются не часто, но иногда мы обнаруживаем, что незначительная часть работает неправильно, или может быть короткое замыкание в проводе, поэтому сигнал со двора не передается должным образом.Ребята, которые руководят нашим заводом, знают завод с головы до ног. Мы знаем, как должен функционировать каждый отдельный компонент. В случае незначительных проблем с компьютером любой из нас может исправить это. Единственный раз, когда нам понадобится помощь извне, — это если что-то пойдет не так с центральным компьютером.

Завод в Галесбурге представляет собой барабанную установку непрерывного действия. После того, как заполнитель, песок и переработанный асфальт взвешены, смешаны и высушены, пламя проходит через большую горелку и нагревает материал.Затем в смесь вводится масло, которое хранится в двух отапливаемых и изолированных силосах. «Мы можем держать готовый асфальт в течение дня, но не храним его на ночь».

Заключительный этап контроля качества проводится на стройплощадке. «Мы следим за тем, как асфальт проходит через асфальтоукладчик, а также за его прикатыванием и уплотнением». Для проверки уплотнения используются датчики ядерной плотности. Мы стремимся к соблюдению определенных стандартов в отношении степени уплотнения смесей. Это большой параметр контроля качества.”

Завод в Галесбурге работает на природном газе последние 5 лет. «Некоторое время мы использовали отработанное масло в качестве топлива. Однако стоимость отработанного масла продолжала расти, и качество от партии к отгрузке сильно варьировалось. Это был темпераментный продукт, от которого нельзя было рассчитывать, что он даст ровное пламя. Мы обнаружили, что у природного газа есть много преимуществ ».

Последние пару лет асфальтовая промышленность в районе Налла упала. В обычный год завод в Галесбурге производит около 60 000 тонн асфальта, из которых около 15% использует РАП.В тот день, когда мы посетили завод прошлой зимой, там стояли большие груды битого асфальта, ожидающие утилизации.

United Contractors Midwest (UCM) владеет 16 асфальтобетонными заводами от Блумингтона до Декейтера в южной части штата. У них также есть подразделение в Миссури.

В последние годы переработанный бетон, вероятно, был крупнейшими продавцами на заводе в Галесбурге: ежегодно производилось около 25 000 тонн полностью переработанного продукта. В сезон на заводе работает от шести до восьми человек, а зимой — небольшой персонал, включая Налла.

Какая экономия достигается при использовании переработанного асфальта в смеси? «Экономия зависит от конкретной смеси, которую вы используете в данный момент, и от общего объема переработанного продукта, который вы используете. Средняя экономия на этом заводе, вероятно, составляет от 15 до 20% », — подсчитал Налл.

GUNTHER — дизайнер, создавший раскрученный образ PFW Offset

Все взоры прикованы к Парижу, поскольку неделя моды захватывает французскую столицу. Посетите наш центр Недели моды в Париже осень / зима 2019, чтобы узнать все последние новости от лучших домов, брендов и дизайнеров отрасли.

Ранее на этой неделе Offset Migos выступил в монохромной кройке, в результате чего он стал королем Drip King Недели моды в Париже еще до того, как все началось. (По крайней мере, пока не появился Люсьен Кларк.) Образ включал норковую шубу Louis Vuitton, водолазку Balenciaga, груды льда Eliantte и брюки, созданные лейблом, о котором люди почти не слышали: GUNTHER.

Изготовленные из плотной шерстяной ткани и украшенные толстой веревкой вокруг талии, четкие, большие брюки GUNTHER были ярким изюминкой наряда.В одно мгновение парижский лейбл был вырван из безвестности и брошен в центр внимания, как раз в тот момент, когда весь мир моды обрушился на французскую столицу.

GUNTHER — детище выпускницы школы дизайна Parsons Наоми Гюнтер, которая понятия не имела, что через шесть месяцев после окончания учебы и возвращения домой, чтобы запустить свой собственный лейбл мужской одежды, мужчина Migos поддержит ее, и ее работа будет сочетаться с этим. Верджила Абло.

Мы связались с 23-летним дизайнером, чтобы обсудить все: от соавторов Offset и восхищения стилем A $ AP Rocky до того, что олицетворяет ее бренд и чего мы можем ожидать от ее предстоящей коллекции.Читайте ниже.

Как вы бы описали GUNTHER? У вас есть фирменная эстетика?

GUNTHER — это сочетание старинного ноу-хау и современной эстетики, аутентичного парижского пейзажа и творческого безумия, привнесенного прямо из Нью-Йорка.

Бренд создает мужской гардероб из пересмотренной и модернизированной классики под влиянием городского стиля. Некоторые изделия украшены уличными мотивами и [производятся] с использованием изысканных высококачественных материалов, предлагая элегантную уличную одежду с крупными фасонами и оригинальным дизайном.

Не могли бы вы рассказать нам, как возникла офсетная связь?

Заинтересованные первыми изделиями GUNTHER, команда стилистов Офсета связалась с нами за несколько дней до его приезда в Париж [и попросила нас] подготовить для него наряды для Недели моды в Париже.

Среди вещей, которые мы им предложили, внимание Офсета привлекли наши штаны. Плотная ткань, эффект выцветания, почти индустриальная текстура и толстая веревка на талии оказали влияние на него, а затем и на пресс. Эти брюки [были] разработаны как один из самых первых прототипов GUNTHER.Для нас это элегантная и оригинальная модель streetwear: уличная по форме, элегантная, изысканная и оригинальная по дизайну.

Вы ожидали, что он будет носить ваши рисунки?

На самом деле мы обнаружили, что Офсет носил штаны в социальных сетях в то же время, что и все остальные. Это было неожиданностью даже для нас. Потом вся пресса взорвалась, и мы стали видеть имя бренда повсюду.

Вы всегда играете с тяжелыми тканями, текстурами и деталями из веревок, или эти брюки — исключение?

Да, я всегда играю на текстурах.Я черпаю вдохновение из Парижа, моего родного города. Меня вдохновляет все: улицы, тротуары, городской пейзаж — все типично для Парижа. Я стараюсь делать то же самое со своей одеждой — смешивать материалы и создавать принты из фотографий, которые я делаю каждый день.

Кто на вас больше всего повлиял?

Меня вдохновляет искусство в целом, в основном сюрреализм, который переосмысливает реальность и создает свой собственный мир. Это бросает вызов языку, общению, видению и восприятию, которые я стараюсь воссоздавать в процессе проектирования.Меня очень вдохновляет визуальный художник Жан-Мишель Баския за его аутентичность и уникальность. Он очень сырой в своем творчестве и исследует свою личность через искусство.

Как дизайнер меня очень вдохновляет [Мартин] Маржела. У него такое огромное творчество и он знает, как сделать заявление из чего угодно. Его творчество выходит за рамки одежды. Знаменитостью, которая великолепно одевается, будет A $ AP Rocky. Что касается французского стиля, мне нравится отношение Венсана Касселя.

Вы упомянули, что работаете с сообществом и стремитесь к устойчивому производственному процессу.Не могли бы вы рассказать нам об этом поподробнее?

Все трикотажные изделия в моей коллекции сделаны вручную парижскими пенсионерами, женщинами, которые живут одиноко, иногда просто занимаются вязанием в качестве страсти или зарабатывают себе на жизнь. Сделано во Франции, бренд также ставит во главу угла окружающую среду. Использование био или натурального сырья, такого как шерсть, а также переработанных или непроданных материалов, а также мелкомасштабное производство во избежание отходов — это подход, который требует максимальной экологической ответственности.

Чего нам ожидать от вашей новой коллекции?

Новая коллекция — продолжение того, что олицетворяет GUNTHER. Мы работаем с уличными мотивами, тяжелыми текстурами, деталями из веревок, изысканными материалами и кроем, а также оригинальными дизайнами. В этой коллекции Париж станет главным источником вдохновения.

Когда откроется ваш интернет-магазин?

Интернет-магазин должен выйти в конце февраля.

Холли Гюнтер // Демократ // Государственный дом — район 3

Холли Гюнтер // Демократ // Дом государства-Район 3

1.Как искусство, культура и / или гуманитарные науки повлияли на вашу жизнь?

В настоящее время я работаю в совете общественной театральной труппы в Логане. Я видел, как их жизнь менялась благодаря участию в искусстве. Я также видел положительный эффект, который искусство может иметь на общество и отдельные семьи. Они обладают силой преподавать неизгладимые уроки жизни и условий жизни человека.

2. В сфере гуманитарных наук и искусств штата Юта занято 123 000 юанцев, их заработок составляет 4,4 миллиарда долларов и 13 долларов США.2 миллиарда продаж. Это более серьезное экономическое воздействие, чем сельское хозяйство, горнодобывающая промышленность и недвижимость. Считаете ли вы сектор искусства и культуры двигателем экономики в Юте?

Есть

3. Я поддерживаю …

-Гранты для использования в кратчайшие сроки (работы)

— Сохранение срочных кредитов для некоммерческих организаций

-Защита налогов ПДП, чтобы деньги, предоставленные культурным организациям, не были перепрофилированы

-Увеличение доступности кредитов для культурных предприятий (некоммерческих и коммерческих)

— Бюджетно-ответственные государственные инвестиции в художественные и гуманитарные организации

— Культурные районы

-Содействие партнерству между туризмом и культурой

-Снижающие нормы творческого бизнеса

-Капитальные вложения (в музеи, концертные залы, студии, галереи, офисные помещения для некоммерческих организаций и т. Д.))

— ПДП

-Существующие остатки средств, которые будут сохранены для отдыха, культурных организаций и парков

-Процентная доля программ общественного искусства, которые, возможно, определяют 1% государственных капитальных затрат на общественное искусство

— Разрешить муниципалитетам устанавливать стандарты проектирования

-K-6 Учащиеся должны иметь больше возможностей для получения гуманитарного и гуманитарного образования

-7-12 Учащиеся должны иметь больше возможностей для получения гуманитарного и гуманитарного образования

— Программа обучения искусству Беверли Тейлор Соренсон, по которой в большинство начальных школ попадает один специалист по искусству.

— Программа POPS (Программа профессиональной помощи в школах), которая направляет 13 организаций профессионального искусства во все школьные округа UT

— Программа iSEE (неформальное научное образование), которая направляет 10 организаций, занимающихся профессиональной наукой, зоологией и естествознанием, во все школьные округа UT

4.Финансово ответственные государственные инвестиции в искусство и гуманитарные науки (включая гуманитарное и художественное образование) означают для меня:

Понимание экономической взаимосвязи между искусством и финансовой выгодой для области, а также инвестирование и уважение к искусству за то влияние, которое они могут принести сообществу.

Нонсенс вариант фактора обмена Rap Guanine Nucleotide Exchange Factor 5 (RAPGEF5) связан с семейным изолированным гипопаратиреозом лошадей у ​​чистокровных жеребят

Abstract

Идиопатическая гипокальциемия у чистокровных (ТБ) жеребят вызывает тетанию и судороги и неизменно приводит к летальному исходу.Основываясь на сходстве этого заболевания с семейным гипопаратиреозом человека и встречаемости только у туберкулезной породы, мы провели генетическое исследование двух пораженных туберкулезом жеребят. Был выявлен семейный гипопаратиреоз, а анализ родословной позволил предположить аутосомно-рецессивный (АР) тип наследования. Мы выполнили полногеномное секвенирование двух жеребят, их здоровых маток и четырех здоровых, неродственных лошадей с туберкулезом. Как картирование гомозиготности, так и ассоциативный анализ использовались для определения приоритетности потенциальных генетических вариантов.Из 2808 вариантов, которые значимо связаны с фенотипом с использованием режима наследования AR ( P <0,02) и расположены в области гомозиготности, 1507 (54%) были расположены в области 9,7 Mb на chr4 (44,9–54,6 Mb). ). В этой области бессмысленный вариант ( RAPGEF5 c.2624C> A, p.Ser875 *) был значительно связан с фенотипом гипопаратиреоза ( P аллель = 0,008). Пораженные жеребята были гомозиготными по этому варианту, а в 2019 году было подтверждено еще два пораженных жеребца.Вскрытие всех пораженных жеребят не выявило гистологически нормальных паращитовидных желез. Поскольку нонсенс-мутация в RAPGEF5 находилась рядом с С-концом белка, влияние на функцию белка было неясным. Поэтому мы протестировали этот вариант на нашей модели сверхэкспрессии Xenopus и продемонстрировали потерю функции RAPGEF5. Этот вариант RAPGEF5 представляет собой первый генетический вариант гипопаратиреоза, идентифицированный у любых видов домашних животных.

Информация об авторе

Индустрия чистокровного разведения в Соединенных Штатах приносит общий доход в 6 миллиардов долларов. Смертельный гипокальциемический синдром был впервые описан у молодых чистокровных лошадей в 1997 году. Заболевшие жеребята страдают судорогами из-за низкой концентрации кальция в крови в первые несколько недель жизни. Наша клиническая оценка пораженных жеребят подтвердила диагноз первичного гипопаратиреоза, и это заболевание, по-видимому, передается по аутосомно-рецессивному признаку.Полногеномное секвенирование двух пораженных жеребят выявило бессмысленный вариант в RAPGEF5 . Впоследствии были генотипированы еще два пораженных жеребца, которые также были гомозиготными по бессмысленному варианту. Избыточная экспрессия лошадиного варианта в эмбрионах лягушки продемонстрировала потерю функции. Генетическое тестирование теперь доступно для скрининга носителей чистокровных, и болезнь была переименована в изолированный семейный гипопаратиреоз лошадей (EIFH).

Образец цитирования: Rivas VN, Magdesian KG, Fagan S, Slovis NM, Luethy D, Javsicas LH, et al.(2020) Нонсенс вариант фактора обмена гуаниновых нуклеотидов 5 ( RAPGEF5 ) связан с семейным изолированным гипопаратиреозом лошадей у ​​чистокровных жеребят. PLoS Genet 16 (9): e1009028. https://doi.org/10.1371/journal.pgen.1009028

Редактор: Грегори С. Барш, Институт биотехнологии Хадсон-Альфа, США

Поступило: 28 апреля 2020 г .; Дата принятия: 5 августа 2020 г .; Опубликовано: 28 сентября 2020 г.

Авторские права: © 2020 Rivas et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Данные о последовательности полного генома, полученные в этом исследовании, были отправлены в базу данных NCBI BioProject (https://www.ncbi.nlm.nih.gov/bioproject/) под регистрационным номером (PRJNA601992).

Финансирование: Поддержка этого исследования была предоставлена ​​Центром охраны здоровья лошадей Калифорнийского университета в Дэвисе (CEH) C.J.F (CEH 17-14 и 20-6; https://ceh.vetmed.ucdavis.edu/). Дополнительная поддержка C.J.F. был предоставлен NIH (K01OD015134) и L40 TR001136. С.Ф. и MKK были поддержаны NIH / NICHD R01HD081379 (https://www.nih.gov/). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

Версия Википедии: https: // en.wikipedia.org/wiki/A_nonsense_variant_in_Rap_Guanine_Nucleotide_Exchange_Factor_5_(RAPGEF5)_is_associated_with_equine_familial_isolated_hypoparathyroidism_in_Thoroughbred_foals

Введение

Отрасль племенного разведения чистокровных (ТБ) в Соединенных Штатах приносит в целом 6 миллиардов долларов [1]. Ежегодно в Соединенных Штатах рождается около 20 000 жеребят с туберкулезом, и из ~ 7 000, проданных в качестве годовалых, средняя цена на одного молодняка составляет примерно 77 000 долларов [2]. Следовательно, любое генетическое заболевание, которое приводит к потере чистокровного жеребенка, имеет огромные экономические последствия.

В 1997 г. было описано пять случаев рефрактерной гипокальциемии у жеребят с туберкулезом с клиническими признаками, включая тетанию, жесткую походку и гипергидроз. Четыре жеребенка умерли, а пятый был усыплен на основании осторожного прогноза [3]. У этих жеребят была гипокальциемия, как правило, гиперфосфатемия, а также низкие или нормальные концентрации паращитовидных желез (ПТГ), несмотря на гипокальциемию, что свидетельствует о гипопаратиреозе. Четверо жеребят прошли полное вскрытие трупа. Несмотря на обширные исследования, ткань околощитовидной железы не может быть идентифицирована ни грубо, ни гистологически [3].

У людей первичный гипопаратиреоз возникает в результате ятрогенных причин (например, хирургического удаления), аутоиммунного полигландулярного синдрома или наследственных причин. Семейный изолированный гипопаратиреоз включает аутосомно-рецессивный, аутосомно-доминантный и Х-сцепленный рецессивный подтипы. Пациенты страдают гипокальциемией и часто гиперфосфатемией, гипомагниемией и имеют неадекватно низкие или нормальные концентрации ПТГ. Симптомы и возраст начала чрезвычайно разнообразны и зависят от степени гипокальциемии, от бессимптомной до тяжелой с рецидивирующими припадками в младенчестве [4].На сегодняшний день генетические мутации идентифицированы в четырех генах. Патогенные мутации гена паратироидного гормона ( PTH ) и глиальных клеток, в которых отсутствует фактор транскрипции 2 (GCM2 ), были связаны как с аутосомно-доминантным, так и с рецессивным гипопаратиреозом. GCM2 — единственный фактор транскрипции, экспрессия которого ограничена паращитовидными железами, и он считается вторичным механизмом регуляции кальция [5]. Аутосомно-доминантная гипокальциемия типа 1 в первую очередь вызвана мутациями в гене кальций-чувствительного рецептора ( CASR ) [4], в то время как мутации в гене G белковой субъединицы альфа 11, ( GNA11 ) приводят к аутосомному типу 2 типа. доминантная гипокальциемия [6]. CASR кодирует рецептор, чувствительный к кальцию (CaSR), ответственный за увеличение секреции ПТГ во время гипокальциемии. GNA11 кодирует Gα11, ключевой медиатор в передаче сигналов CaSR. Другой ген, транзиентный канал рецепторного потенциала меластина 6 ( TRPM6 ), как сообщается, способствует гипомагниемии с вторичной гипокальциемией у людей [7].

На сегодняшний день не было обнаружено генетических мутаций, связанных с первичным гипопаратиреозом ни у одного вида домашних животных.Мы выполнили полногеномное секвенирование двух пораженных туберкулезом жеребят с семейным гипопаратиреозом для выявления связанных генетических вариантов в пределах кандидатов или новых генов, связанных с фенотипом. Сходные клинические проявления семейного изолированного гипопаратиреоза у людей и идиопатической гипокальциемии лошадей привели к гипотезе, что вариант кодирования в пределах PTH , GCM2 , CASR , GNA11 или TRPM6 может быть связан с идиопатической гипокальциемией ТБ. жеребят.Мы окончательно исключили эти гены-кандидаты у жеребят туберкулеза с семейным гипопаратиреозом и вместо этого идентифицировали бессмысленный вариант в RAPGEF5 c.2624C> A, p.Ser875 *, который в значительной степени ассоциировался с фенотипом. Чтобы проверить влияние этого варианта лошади на функцию, мы использовали модель сверхэкспрессии в Xenopus и обнаружили, что вариант лошади RAPGEF5 был аллелем потери функции.

Результаты

Анализ родословной

Были получены родословные двух пораженных в 2017 г. жеребят ( случаев № 1 и 2 ), и был проведен анализ родословных с помощью программы Pedigraph [8].Было установлено, что отец одного больного жеребенка является дедушкой другого пострадавшего жеребенка. Кроме того, жеребята были родственниками по материнской линии в пределах шести поколений. Эти данные анализа родословных указывают на аутосомно-рецессивный тип наследования заболевания (, рис. 1, ). Впоследствии в родословную были добавлены два дополнительных жеребя 2019 года ( случаев № 3 и 4 ), что расширило родословную на ~ 12 поколений ( S1, рис. ).

Рис. 1. Родословная пробанда чистокровных жеребят, пораженных идиопатической гипокальциемией.

Был проведен анализ родословных двух пораженных пробандом жеребят ( случаев № 1 и 2 ) с использованием Pedigraph (8). Было обнаружено, что отец одного пораженного жеребенка является дедушкой другого пострадавшего жеребенка (фиолетовый круг). Кроме того, жеребята были связаны по линии плотины в пределах шести поколений (зеленый кружок). Круги = самки, квадраты = самцы, красный = пораженные жеребята, желтый = здоровые лошади, черный = лошади, недоступные для оценки.

https://doi.org/10.1371/journal.pgen.1009028.g001

Результаты аутопсии

Клинико-патологические результаты подтвердили диагноз гипопаратиреоза у всех жеребят (см. Методы ), и было проведено полное вскрытие трупа. В исследованных тканях из случаев № 1 и 2 не было макроскопических или гистологических повреждений. Исследованные ткани включали головной мозг, мозжечок, ствол мозга, гипофиз, сердце, печень, легкие, почки, надпочечники, селезенку, тимус, щитовидную железу, желудок, тонкий кишечник, толстую кишку и диафрагму.Несмотря на тщательное обследование, ни в том, ни в другом случае паращитовидные железы не удалось идентифицировать ни крупно, ни гистологически. В случае № 3 выявлена ​​мультифокальная миодегенерация и некроз скелетных мышц. Нормальные паращитовидные железы гистологически не наблюдались. Однако кистозная структура была идентифицирована рядом с щитовидной железой (, рис. 2А, ). Эта структура имела рассеянную иммунную метку для ПТГ, кальцитонина и тиреоглобулина ( Fig 2B – 2D ) и была интерпретирована как эмбриологический остаток, возможно, частично полученный из глоточного мешка.

Рис. 2. Вскрытие трупа , дело № 3 .

Нормальные паращитовидные железы гистологически не наблюдались. Однако кистозная структура была идентифицирована рядом с щитовидной железой (A; стрелка = щитовидная железа, шкала = 100 мкм;), BD. Эта кистозная структура имела рассеянную иммунореактивность для (B) ПТГ, (C) кальцитонина и (D) тиреоглобулина. (шкала = 50 мкм).

https://doi.org/10.1371/journal.pgen.1009028.g002

В случае Случай № 4 патологические находки включали умеренный регионально обширный отек в подкожной клетчатке шеи и плеч; умеренный очаговый отек забрюшинного пространства; тяжелый подострый язвенный гастрит; легкая, острая интерстициальная пневмония; умеренная диффузная синусоидальная нейтрофилия в печени; и кокцидиоз тонкого кишечника.Не было обнаружено гистологических аномалий в следующих тканях: ствол мозга, мозжечок, головной мозг, сердце, ягодичные мышцы, почки, щитовидная железа, тимус, поджелудочная железа, гипофиз, мочевой пузырь, яички, надпочечник, язык, диафрагма, двенадцатиперстная кишка, тощая кишка, тонкая кишка, толстый кишечник и глаз. Ткань паращитовидных желез не была заметна ни крупно, ни гистологически.

Картирование гомозиготности и исключение генов-кандидатов

Мы выполнили полногеномное секвенирование первых двух жеребят 2017 г. (8.6 и 9,2x), их матери (8,9 и 9,1x) и два неродственных здоровых туберкулеза (8,3 и 8,7x) при среднем охвате 8,8x. Данные полногеномных последовательностей еще двух неродственных здоровых ТБ из архива функциональной аннотации геномов животных (FAANG) были использованы в качестве дополнительных контрольных лошадей (https://www.ebi.ac.uk/ena/data/view/PRJEB26698) Картирование гомозиготности выявило 23 региона с одним и тем же гомозиготным аллелем, общим у двух жеребят (средняя длина 3,41 ± 2,54 МП, диапазон 0,43–10,8 МБ; S1 таблица ).На основании местоположения гена-кандидата все гены-кандидаты ( PTH , GCM2 , CASR , GNA11 и TRPM6 ) были исключены, поскольку эти гены не были расположены в областях гомозиготности, общих для двух пораженных жеребят. Следовательно, эти пять генов-кандидатов вряд ли могут быть вовлечены в семейный гипопаратиреоз жеребят туберкулеза.

Исследование ассоциации полного генома

Затем было проведено полногеномное ассоциативное исследование для изучения генетической причины идиопатической гипокальциемии.Варианты были отфильтрованы по предложенному типу наследования (гомозиготные альтернативы у двух пораженных жеребят и гетерозиготные у их самок), в результате было получено 66 112 вариантов по всему геному. Эти варианты были дополнительно отфильтрованы с использованием значения аллеля Фишера P <0,02, что позволило бы иметь одну гетерозиготу в контрольной популяции (расчетное точное значение аллеля Фишера P = 0,019). Затем полученные 4973 варианта сравнивали с идентифицированными областями гомозиготности для выявления перекрытия.

Только шесть из 38 областей гомозиготности содержали варианты, которые были в значительной степени связаны с фенотипом ( S1 и S2, таблицы ). В эти шесть регионов было включено 2808 вариантов, связанных с фенотипом. Две из этих областей были расположены на chr4, охватывая от 44940057–49262454 (одна область) до 49326336–54598022 (вторая область), и включали 1507 (54%) ассоциированных, отфильтрованных по регионам, вариантов.

2808 вариантов, попадающих в области гомозиготности, были дополнительно отфильтрованы по эффекту («Умеренный» и «ВЫСОКИЙ») с использованием SnpEff [9] и скринированы в базе данных NCBI SRA (https: // ncbi.nlm.nih.gov/subs/sra/). Только варианты на chr4 и chr6 содержали «умеренные» эффекты, которые были выявлены у других пород (, таблица 1, ). Единственный ассоциированный бессмысленный вариант с «ВЫСОКИМ» эффектом был на chr4 (EquCab3.0 chr4: 54108297) в экзоне 26 RAPGEF5 (c.2624C> A p.Ser875 *) и был исключительным для TB.

Таблица 1. «СРЕДНИЙ» и «ВЫСОКИЙ» генетические варианты, значимо связанные с идиопатической гипокальциемией у чистокровных жеребят (аллель P <0.02).

Ассоциированные варианты в регионах гомозиготности были проверены на 123 лошадях 12 пород с использованием базы данных NCBI SRA (https://ncbi.nlm.nih.gov/subs/sra/). AT = ахалтекинская, FM = франшско-монтаньская, FD = фризская карликовая, GWB = немецкая теплокровная, HF = хафлингерская, ICE = исландская, KWB = конинклийская теплокровная, QH = четверть лошади, SH = шетландские пони, STBD = стандартбред, SWB = Швейцарская теплокровная, YH = Якутская лошадь. На момент скрининга в базе данных NCBI SRA не было обнаружено других чистокровных (ТБ).

https://doi.org/10.1371/journal.pgen.1009028.t001

Подтверждение варианта посредством секвенирования по Сэнгеру

Было собрано

ДНК жеребят 2017 и 2019 годов, их самок и одного из производителей жеребят, и было проведено секвенирование по Сэнгеру для предполагаемого варианта RAPGEF5 (c.2624C> A p.Ser875 *). Все четыре жеребенка были гомозиготными по этому варианту, и все матери и один испытанный родитель были гетерозиготными. ДНК от отцов других жеребят были недоступны.

Еще 82 других доступных незараженных чистокровных лошади были случайным образом выбраны из нашей базы данных и генотипированы. Из 82 лошадей три были гетерозиготными по бессмысленному варианту, а остальные лошади были гомозиготными по дикому типу ( S3, таблица ). Эти три лошади не были связаны друг с другом в течение трех поколений, но могли быть связаны обратно с четырьмя пораженными жеребятами в течение 3–6 поколений. Частота аллеля для варианта RAPGEF5 была рассчитана для популяции 82 чистокровных лошадей ( q = 0.018).

RAPGEF5 сохранение и экспрессия

Аминокислота, измененная ассоциированным бессмысленным вариантом в RAPGEF5, c.2624C> Ap.Ser875 * и 6/7 оставшихся аминокислот в RAPGEF5, на 100% консервативны у 100 видов позвоночных (https: // genome. ucsc.edu/; Рис. 3 ). Выравнивание мРНК изоформы X1 лошади предсказывало RAPGEF5 (XM_023639352.1) с изоформой X2 лошади (XM_023639353.1), а пять проверенных последовательностей мРНК RAPGEF5 человека выполняли с использованием BLAST [10].Только варианты человеческого транскрипта 1, 4 и 2 простирались до 3 ’конца лошади RAPGEF5 , где находился бессмысленный вариант ( S4, таблица ). Последовательности белка RAPGEF5 из двух полученных предсказанных белков NCBI лошадей (изоформа X1; XP_023495120.1; 882 аминокислотных остатков и изоформа X2; XP_023495121.1; 881 аминокислотных остатков), трех белков RefSeq человека, которые простираются до 3′-конца аннотированного белка лошади ( NP_036426.4, NP_001354529 и NP_001354531.1), единственный мышиный белок RefSeq (NP_787126.3) и четыре предсказанных белка Xenopus tropicalis (XP_031759510.1, XP_031759509.1, XP_017950421.2 и XP_031759511.1) были выровнены, демонстрируя сильную консервацию даже в пределах альтернативных изоформ RAPGEF5 ( рис. 3 ). Из двух предсказанных лошадиных белков (изоформа X1; XP_023495120.1, кодируемая XM_023639352.1 и изоформа X2; XP_023495121.1, кодируемая XM_023639353.1), единственное различие — дополнительный глутамин в положении p.332 в изоформе 1. Следовательно, в зависимости от используемой модели транскрипции, бессмысленный вариант RAPGEF5 либо аннотируется как c.2624C> A, p.Ser875 * (изоформа X1) или c.2621C> A, p.Ser874 * (изоформа X2). Однако при сравнении сопоставлений с человеком, мышью и Xenopus предсказанная изоформа X1, содержащая глутамин на стр. 332, более вероятно основана на консервации ( S2 рис. ). Поэтому мы аннотировали этот бессмысленный вариант на основе изоформы X1 ( RAPGEF 5 c.2624C> A, p.Ser875 *).

Рис. 3. Выравнивание белковых последовательностей между Xenopus tropicalis , Equus caballus , Mus musculus и Homo sapiens .

последовательности белка RAPGEF5 из двух предсказанных белков NCBI лошади (изоформа X1 = XP_023495120.1 и изоформа X2 = XP_023495121.1), трех белков RefSeq человека, которые простираются до 3′-конца аннотированного белка лошади (NP_036426.4 = изоформа 1, NP_001354529 = изоформа 2 и NP_001354531.1 = изоформа 4), единственный мышиный белок RefSeq (NP_787126.3 = изоформа 2) и четыре предсказанных Xenopus tropicalis (изоформа 2 = XP_031759510.1, изоформа 1 = XP_031759509.1, изоформа 3 = XP_017950421.2 и изоформа 4 = XP_031759511.1) были выровнены, демонстрируя сильную консервативность даже в альтернативных изоформах RAPGEF5. Остаток серина, измененный с помощью RAPGEF 5 c.2624C> A, p.Ser875 *, выделен черной стрелкой в ​​конце выравнивания последовательностей.

https://doi.org/10.1371/journal.pgen.1009028.g003

В 45 тканях лошадей с общедоступными данными секвенирования РНК из инициативы Functional Annotation of Animal Genomes (FAANG) (https: // www.ebi.ac.uk/ena/data/view/ERA1487553) [11], две аннотированные NCBI транскрипты лошадей (https://www.ncbi.nlm.nih.gov/assembly/GCF_002863925.1/) RAPGEF5 (XM_023639352.1 и XM_023639353.1) были наиболее высоко экспрессированы в головном и спинном мозге ( рис. 4A и 4B, соответственно). Поскольку ткань паращитовидных желез не была включена в эту базу данных, атлас белков человека был использован для оценки экспрессии RAPGEF5 в тканях паращитовидных желез (https://www.proteinatlas.org/). Экспрессия белка RAPGEF5 была повсеместной; однако экспрессия транскриптов была увеличена в головном мозге (согласованная нормализованная экспрессия (Nx) 20-40, спинной мозг (Nx = 67)) и в эндокринных тканях.Из всех тканей паращитовидная железа имела самую высокую экспрессию РНК RAPGEF5 (Nx = 258) ( Fig. 4C ). В то время как ткань паращитовидной железы не была идентифицирована ни у одного пораженного жеребенка, ткань была собрана у здорового контрольного жеребенка и продемонстрирована экспрессия RAPGEF5 ( Fig. 4D ).

Рис. 4. Экспрессия транскрипта RAPGEF5 в тканях лошади (A, B) и человека (C).

В 45 тканях лошадей с общедоступными данными секвенирования РНК из инициативы FAANG два NCBI аннотировали лошадиные транскрипты RAPGEF5 (A) XM_023639352.1 и (B) XM_023639353.1 были наиболее высоко экспрессированы в головном и спинном мозге (зеленый цвет; медиана и 95% доверительный интервал графически изображены для n = 2 лошадей). Ткани околощитовидной железы в этот биобанк не вошли. (C) У людей экспрессия транскрипта RAPGEF5 была увеличена в нервной системе (зеленый) и эндокринных тканях (фиолетовый). Паращитовидная железа имела самую высокую экспрессию РНК RAPGEF5 . FPKM = количество фрагментов на килобазу транскрипта на миллион отображенных считываний, Nx = согласованная нормализованная экспрессия.(D) RAPGEF5 экспрессируется в ткани паращитовидной железы здорового контрольного жеребенка (наборы праймеров, охватывающие экзоны 19-20; ожидаемый размер продукта 178 п.н.). Два набора праймеров, охватывающие экзоны 3–4 и 4–5 из CASR , использовали в качестве внутреннего контроля для подтверждения ткани паращитовидной железы.

https://doi.org/10.1371/journal.pgen.1009028.g004

Структура белка

Поиск структуры

RAPGEF5 проводился с использованием банка данных RCSB Protein Data Bank (http://www.rcsb.org/) [12].Используя полное представление об особенностях белка, сайт фосфорилирования был идентифицирован в аминокислотном остатке, который мутирован у этих жеребят (p.Ser573) в мотиве Ras-GEF ( S3, рис. ). Этот сайт фосфорилирования был идентифицирован в Т-лимфоцитах с помощью масс-спектрометрии [13].

RAPGEF5 c.2624C> A p.Ser875 * приводит к потере функции кодируемого белка

Хотя генетический анализ и анализ экспрессии убедительно свидетельствуют о связи аллеля p.Ser875 * с идиопатической гипокальциемией у пораженных жеребят, нонсенс-мутация находится очень близко к С-концевому концу белка.Следовательно, влияние такого усечения на функцию белка было неясным. Чтобы проверить это, мы сверхэкспрессировали лошадь RAPGEF5 в Xenopus tropicalis . Ранее мы показали, что RAPGEF5 влияет на передачу сигналов Wnt и что избыточная экспрессия человеческого RAPGEF5 в Xenopus может драматически изменять эмбриональное развитие [14]. Мы микроинъектировали лошадиных животных дикого типа RAPGEF5 и лошадиного варианта RAPGEF5 и сравнивали эмбриональное развитие с контрольными эмбрионами без инъекций.В то время как неинфицированные контрольные эмбрионы не имели фенотипа развития (0%), эмбрионы, которым вводили мРНК GFP, имели небольшой дефект развития (13% легкие и 6% умеренные / тяжелые). Напротив, сверхэкспрессия мРНК RAPGEF5 лошади дикого типа привела к значительному увеличению тяжелых (53%) дефектов развития у эмбрионов стадии 28, при этом 12% имели умеренный фенотип и 24% — умеренный. Следует отметить, что эти фенотипы согласуются с известной активностью RAPGEF5, а именно с активацией передачи сигналов Wnt (напр., Потеря структур головы в Fig 5C ; [14, 15]).Только 12% эмбрионов, которым инъецировали мРНК RAPGEF5 лошади дикого типа, оказались нормальными ( рис. 5; P <0,005). Однако сверхэкспрессия лошадиного варианта S875 * RAPGEF5 давала преимущественно эмбрионы дикого типа (66%), а остальные эмбрионы имели мягкий (15%), умеренный (9%) или тяжелый (10%) фенотип. Степень тяжести этих эмбриональных фенотипов оказалась немного выше, чем у эмбрионов, инъецированных GFP, но значительно меньше, чем у эмбрионов, инъецированных мРНК RAPGEF5 дикого типа ( Fig. 5E ).На основании этих исследований мы пришли к выводу, что вариант p.Ser875 * является аллелем потери функции.

Рис. 5. Модель сверхэкспрессии в Xenopus идентифицирует лошадиный вариант RAPGEF5 как аллель потери функции.

Сверхэкспрессия мРНК лошади RAPGEF5 влияет на эмбриональное развитие у Xenopus tropicalis ; однако конский вариант S875 * RAPGEF5 имеет значительно меньший эффект. (A) Нормальное развитие в не введенном контроле X . tropicalis эмбрионов. Все эмбрионы — виды сбоку, спереди слева и дорсально вверх. (B) Незначительно влияет на развитие. Эмбрионы демонстрируют нарушение удлинения вдоль передне-задней оси и замедленное формирование глаз и хвоста. (C) Умеренно влияет на развитие. В частности, в этой категории эмбрионы не могут образовывать структуры головы (D). Сильно нарушено развитие. Эмбрионы демонстрируют неполное закрытие бластопора, неполную нейруляцию, нарушенное удлинение вдоль передне-задней оси и отсутствие различимых структур головы.(E) Количественная оценка фенотипов эмбрионов без инъекции, инъекции мРНК RAPGEF5 лошади и инъекции мРНК S875 * RAPGEF5 эмбрионов, классифицированных как дикие, легкие, средние и тяжелые на стадии 28. Данные представляют собой компиляцию трех независимых экспериментов. . (*** р <0,0005). A = передний, P = задний, D = дорсальный, черный треугольник = закрашенная стрелка указывает на расположение глаза.

https://doi.org/10.1371/journal.pgen.1009028.g005

Обсуждение

Сходство между семейным изолированным гипопаратиреозом у людей и рефрактерной гипокальциемией, наблюдаемой у чистокровных жеребят, привело к гипотезе, что генетические варианты в PTH , GCM2 , CASR , GNA11 или TRPM6 могут быть ответственными за болезнь лошади.Варианты внутри этих генов не были расположены в регионах гомозиготности, тем самым исключая их как вероятных кандидатов. Затем мы провели исследование ассоциации всего генома, в результате которого была выявлена ​​бессмысленная мутация в RAPGEF5 (c.2624C> A p.Ser875 *). Связь этого варианта с семейным фенотипом гипопаратиреоза лошадей была усилена его глубокой консервацией у разных видов, высочайшей экспрессией транскрипта в ткани паращитовидной железы, подтвержденной ассоциацией у двух дополнительно затронутых жеребят в 2019 году и функциональными исследованиями, демонстрирующими потерю функции с этой ерундой. вариант в нашей животной модели.Таким образом, этот генетический вариант является первым из всех видов домашних животных, ассоциированным с первичным гипопаратиреозом, и RAPGEF5 следует рассматривать как дополнительный ген-кандидат для первичного гипопаратиреоза у людей.

Конский вариант расположен в экзоне 26 RAPGEF5 , который является последним аннотированным экзоном лошади. RAPGEF5 регулирует ядерную транслокацию β-катенина посредством активации ядерных GTPases [14]. Бета-катенин играет центральную роль в управлении несколькими процессами развития посредством передачи сигналов Wnt.Это взаимодействие имеет решающее значение при формировании областей тела у ранних эмбрионов. Связь между путём Wnt / β-catenin и передачей сигналов кальция через PTH наиболее хорошо изучена в костях. ПТГ стимулирует Wnt / β-катенин в остеобластах мыши, что приводит к дифференцировке клеток и образованию костей [16]. Рецептор ПТГ может также активировать путь β-катенина напрямую, рекрутируя адаптерный белок Disheveled, независимо от Wnt [17]. Другая ассоциация с рецепторами, воспринимающими кальций, и передачей сигналов Wnt / β-catenin была описана в толстой кишке, где отключение CaSR увеличивает передачу сигналов Wnt / β-catenin [18].Остаток серина, который мутирован у наших жеребят, коррелирует с предполагаемым сайтом фосфорилирования в RAPGEF5 в мотиве Ras-GEF на С-конце ( S3, рис. ). Действительно, наш анализ сверхэкспрессии в Xenopus ясно демонстрирует, что лошадиный вариант RAPGEF5 не может изменять эмбриональное развитие почти так же эффективно, как аллель дикого типа, указывая на то, что вариантный аллель утратил свою функцию.

Механизм, с помощью которого потеря функции RAPGEF5 приводит к гипопаратиреозу, остается неясным.Модели на животных для оценки функции RAPGEF5 ограничены. Данио с точечными мутациями, ведущими к преждевременным стоп-кодонам, существуют, но не были фенотипированы [19]. В настоящее время нет опубликованных данных по моделям мышей Rapgef5. Несмотря на экспрессию RAPGEF5 в нервной ткани ( Рис. 4A и 4B ), клинические признаки припадков у наших пострадавших жеребят были связаны с тяжелой гипокальциемией и предотвращались с помощью добавок кальция. Следовательно, не было обнаружено первичного неврологического фенотипа.Обширное вскрытие трупа пораженных жеребят не выявило ткани паращитовидной железы. Хотя у здоровых жеребят трудно обнаружить ткань паращитовидной железы, мы использовали иммуногистохимию у одного жеребенка, чтобы оптимизировать нашу оценку. Нормальная ткань околощитовидной железы не обнаружена; однако наблюдалась кистозная структура, прилегающая к щитовидной железе, которая имела рассеянную иммунореактивность к ПТГ, кальцитонину и тиреоглобину (, рис. 2, ). Основываясь на иммунореактивности, неясно, может ли этот остаток быть из первого и второго глоточных карманов, которые развиваются в щитовидную железу, или из третьего и четвертого глоточных карманов, которые развиваются в паращитовидную железу.Таким образом, RAPGEF5 может играть роль в образовании паращитовидной железы, при этом нонсенс-аллель потери функции приводит к аберрантному развитию.

Хотя экспрессия RAPGEF5 в ткани паращитовидной железы человека очевидна ( Fig. 4C ), эти общедоступные наборы данных не указывают, какой транскрипт RAPGEF5 в первую очередь экспрессируется в этой эндокринной ткани. Сопоставление наших полноразмерных зондов кДНК с подтвержденными человеческими изоформами RAPGEF5 дало самый высокий охват в варианте 1 человеческого транскрипта (NM_012294.5; S4 Таблица ). Из 13 транскриптов, предсказанных Ensembl, единственное соответствие NCBI RefSeq — NM_012294.5 (RAPGEF5-213 или ENST00000665637.1). Следовательно, наш зонд кДНК лошади включал консервативную область, обнаруженную в хорошо проверенной изоформе RAPGEF5 человека.

Примечательно, что, в то время как три из наших пациентов были молодыми (возраст 16-4 дней), Случай № 4 не имел тяжелой гипокальциемии до 30-дневного возраста. У этого жеребенка при первоначальном обследовании была лишь легкая гипокальциемия (в возрасте 1 ч; общий кальций 10.7 мг / дл). О таком широком возрастном распределении сообщалось ранее, когда пораженные жеребята были в возрасте от 4 до 35 дней [3]. Жеребята в младенчестве потребляют молоко с высоким содержанием кальция. Поскольку ежедневный прием кальция не дает этим жеребцам проявлять жесткость и судороги, количество кальция в рационе, вероятно, определяет начало и прогресс заболевания. Поэтому мы предполагаем, что количество кальция, потребляемого жеребятами, может варьироваться в зависимости от концентрации кальция в материнском молоке и количества потребляемого молока.

Ограничения этого исследования включают полногеномное секвенирование только двух пораженных жеребят. Жеребята 2019 года были генотипированы напрямую по бессмысленному варианту RAPGEF5 , а не выполняли полногеномное секвенирование, поскольку они не были идентифицированы до тех пор, пока не была обнаружена мутация-кандидат. Это исследование демонстрирует потенциал для исследований ассоциации полногеномного секвенирования с использованием небольшого числа пораженных животных, когда известен способ наследования, и предполагается, что варианты будут иметь умеренный или высокий эффект.Беспристрастное исследование частоты аллелей для этого варианта также не проводилось в породе ТБ. Наконец, роль RAPGEF5 в развитии паращитовидных желез требует дальнейшего изучения.

В заключение, мы идентифицировали бессмысленную мутацию в RAPGEF5 , ведущую к гипопаратиреозу у неонатальных жеребят с туберкулезом. Мы также предлагаем переименовать это заболевание в семейный изолированный гипопаратиреоз лошадей (EFIH). Из-за высокой экономической ценности многих жеребят туберкулеза необходимо проводить генетическое тестирование, чтобы предотвратить размножение носителей, которые производят пораженных жеребят.

Материалы и методы

Животные

Заявление об этике.

Для исследований на лошадях все процедуры были одобрены Комитетом по уходу и использованию животных Калифорнийского университета в Дэвисе (протокол № 20751) и проводились в соответствии с руководящими принципами и правилами. На все коллекции образцов было получено письменное согласие владельцев. Для исследований Xenopus , Xenopus tropicalis содержали и ухаживали за ними в водохозяйственном учреждении в соответствии с Комитетом Институционального ухода за животными и использованием животных Йельского университета (протокол № 2018–11035) и всеми методами, применяемыми в соответствии с этим протоколом.Эмбрионы были произведены и выращены, как описано ранее [14].

2017 кейсов.

Изначально в этом исследовании использовались два жеребенка с диагнозом идиопатическая гипокальциемия. Весной 2017 года 16-часовая туберкулезная кобылка (, случай № 1, ) была госпитализирована в Медицинский институт лошадей Хагьярда (Лексингтон, штат Кентукки) с жесткой походкой, столбнячной слабостью, лихорадкой (105 ° F; референтный диапазон 99–99). 101 ° F) и чрезмерное лежание. При поступлении в это первое посещение жеребенок был ярким и бодрым, но с лихорадкой (102 ° F).Первоначальный анализ крови выявил гипокальциемию (общий кальций 7,0 мг / дл; ссылка: 10,8–12,8 мг / дл), гипомагниемия (общий магний 1,1 мг / дл; ссылка: 2,0–3,2 мг / дл), гиперфосфатемия (8,4 мг / дл; 1,3–6 мг / дл) и повышенных ферментов печени. Несмотря на выраженную гипокальциемию, концентрация ПТГ в сыворотке была нормальной и составляла 1,20 пмоль / л (справочно: 0,60–11,0 пмоль / л). Кобылку поддерживали на высоких дозах внутривенных жидкостей, содержащих глюконат кальция. Последующий анализ крови выявил рефрактерную гипокальциемию (кальций общий 9.8 мг / дл; ионизированный кальций 4,7 мг / дл [ссылка: 5,0–7,0 мд / дл]) и нормальный фосфор 5,7 мг / дл (ссылка: 4,1–6,4 мг / дл). Жеребенок был выписан для перорального приема карбоната кальция и периодических повторных анализов крови. Через месяц после первого посещения (май 2017 г.) жеребенок был повторно госпитализирован после выявления рецидивирующей гипокальциемии (общий кальций 7,9 мг / дл) за три дня до этого. Был установлен внутривенный катетер для проведения инфузионной терапии с кальцием и магнием. Через несколько часов после приема добавки анализ крови выявил разрешенную гипомагниемию, но рефрактерную гипокальциемию.Кобылку выписывали на порошке карбоната кальция перорально три раза в день и кальцитриол внутривенно два раза в неделю. Образцы ДНК и полная родословная от этого жеребенка и его клинически здоровой матери были получены до того, как жеребенок умер после одной пропущенной добавки. Было проведено полное патологоанатомическое исследование.

Второй случай — 2,5-дневный жеребенок ( Случай № 2 ), который был доставлен в Ветеринарную больницу Калифорнийского университета в Дэвисе (Дэвис, Калифорния) в феврале 2017 года с жесткой походкой, ригидностью мышц и неспособностью стоять. .Срок беременности жеребенка был нормальным — 351 день. Нормальных родов не наблюдалось. Жеребенок вёл себя и вёл себя нормально до нескольких часов после родов, когда впервые была обнаружена жесткость мускулов. У жеребенка была лихорадка (103,6 ° F), тахикардия и сильная мышечная ригидность, которая прогрессировала до того, что жеребенок не мог стоять без посторонней помощи. Анализ крови выявил гипокальциемию (общий кальций 6,4 мг / дл; ионизированный кальций 3,25 мг / дл), гипомагниемию (общий магний 1,4 мг / дл; ионизированная гипомагниемия 0.58 мг / дл [ссылка: 1,02–1,7 мг / дл]), гиперфосфатемия (8,4 мг / дл [ссылка: 1,3–6,0 мг / дл]) и несоответствующая нормальная концентрация ПТГ (0,9 пмоль / л). Концентрация витамина D в сыворотке была нормальной и составляла 13 нмоль / л (ссылка: 11–24 нмоль / л). Эти данные соответствовали гипопаратиреозу. Жеребёнку внутривенно вводили кальций, магний, декстрозу и диазепам для расслабления мышц и предотвращения судорог. Жеребенок был переведен на пероральный прием кальция, магния и витамина D после 48-часового периода реакции на внутривенное введение.Жеребенок был выписан по рекомендованному плану приема добавок карбоната кальция, магния и витамина D после получения образцов ДНК и полной родословной от этого жеребенка и его клинически здоровой матери. Владелец сообщил, что у жеребенка через месяц после выписки начались повторяющиеся судороги. Жеребенок прошел полное вскрытие трупа.

Контрольные лошади.

Образцы цельной крови были взяты еще у двух туберкулезных особей (11-летний мерин и 8-летняя кобыла) из исследовательского стада Центра здоровья лошадей Калифорнийского университета в Дэвисе.Обе лошади были клинически здоровы и не имели отношения к пораженным жеребятам и их самкам. Дополнительные образцы незатронутых туберкулезом были взяты от двух кобыл (4 и 5 лет), которые были секвенированы для инициативы «Функциональная аннотация геномов животных» (FAANG), как описано ранее [11], с общегеномными данными, общедоступными в Европейском нуклеотидном архиве. (https://www.ebi.ac.uk/ena/data/view/PRJEB26698).

Экстракция ДНК крови

Геномную ДНК выделяли из образцов цельной крови в соответствии с протоколом набора для экстракции ДНК крови WIZARD (Promega, Мэдисон, Висконсин).Концентрации ДНК в образцах измеряли с помощью QIAxpert (QIAGEN, Hilden, Германия) и разбавляли до 20 нг / мкл.

Секвенирование всего генома

Геномная ДНК шести лошадей была секвенирована на Illumina HiSeq2500 примерно с 9-кратным охватом. Полногеномные последовательности были депонированы в архиве чтения последовательностей NCBI (https://ncbi.nlm.nih.gov/subs/sra/) (PRJNA601992). Файлы Fastq были получены из архива FAANG (https://www.ebi.ac.uk/ena/data/view/PRJEB26698) и обрезаны для обеспечения качества.Считывания были сопоставлены с эталонной последовательностью EquCab3.0 для лошадей [20] с использованием программы BWA for Illumina [21]. Качество отображения оценивалось с помощью Samtools Flagstat [22]. Открытие SNP, INDEL и генотипирование для всех образцов было выполнено для обнаружения варианта с использованием FreeBayes [23].

Отображение гомозиготности

SNPSift [24] был сначала использован для фильтрации результирующего файла .vcf по качеству, используя вариантный порог Phred 30 (Q≥30), а затем был сокращен для сильного локального неравновесия по сцеплению с помощью PLINK (—indep-pairwise 50 50 0.2) [25], оставив 437 062 варианта для картирования гомозиготности. Картирование гомозиготности выполняли в plink с использованием скользящего окна размером 50 т.п.н. с учетом n = 3 гетерозигот в каждом окне (то есть двух самок и одной здоровой лошади). Перекрывающиеся сегменты идентифицировали с использованием гомозиготной группы и далее фильтровали по областям общих гомозиготных аллелей только у двух пораженных жеребят.

Оценка гена-кандидата

Области гена-кандидата

( PTH , GCM2 , CASR , GNA11 и TRPM6 ) сравнивали с областями гомозиготности с использованием EquCab3.0 для каждого гена-кандидата и с учетом 1 kb вверх и вниз по потоку от аннотированных стартовых и стоп-кодонов, используя аннотацию Ensembl для EquCab3.0 (http://m.ensembl.org/Equus_caballus/Info/Annotation) .

Исследование ассоциации полного генома

После исключения областей генов-кандидатов было проведено исследование ассоциации всего генома. SNPSift [24] был впервые использован для фильтрации результирующего файла .vcf по качеству с использованием варианта порогового значения Phred 30 (Q≥30). Затем варианты были отфильтрованы с помощью SNPSift [24], предполагая, что болезнь имеет аутосомно-рецессивный тип наследования.Варианты фильтровали, требуя, чтобы два пораженных жеребенка были гомозиготными вариантами (isHom и isVariant), а две здоровые самки были гетерозиготными (isHet). В результате было получено 66 112 вариантов, которым затем был присвоен статус случай / контроль с использованием SNPSift caseControl с последующей фильтрацией по значению аллеля P <0,02, что позволило получить одну гетерозиготу в контрольной популяции лошадей. В дополнение к оценке существенно связанных вариантов, называемых freebayes, необработанные файлы BAM были визуально проверены с помощью Integrative Genome Viewer [26] в областях генов-кандидатов и областях гомозиготности на предмет любых структурных вариантов, включая дупликации, инверсии и большие делеции или вставки.После сравнения областей с областями гомозиготности, SNPEff затем использовался для прогнозирования влияния на функцию белка альтернативных вариантов в пределах этих областей-кандидатов, классифицируя варианты как имеющие предполагаемые эффекты «ВЫСОКИЙ», «Умеренный», «НИЗКИЙ» или «МОДИФИКАТОР». [24]. Затем варианты с прогнозируемыми эффектами «ВЫСОКИЙ» или «УМЕРЕННЫЙ» были затем проанализированы в общедоступной базе данных полногеномных последовательностей лошадей с использованием базы данных NCBI Sequence Read Archive (SRA) (https://www.ncbi.nlm.nih.gov/sra ) и исключаются, если обнаружены у других пород, кроме туберкулеза.

Проверка последовательности по Сэнгеру

Для подтверждения предполагаемых вариантов, идентифицированных при полногеномном секвенировании, были разработаны праймеры с использованием программного обеспечения Primer3Plus [27] и ДНК-олигонуклеотиды, синтезированные с помощью технологий Invitrogen (F 5’AACGTCTCCCTGTTTCATGC3 ‘, R 5’GCTTGCTGTGTGTCTGTGCTham3’, ). Амплификацию продуктов проводили с помощью ПЦР по конечной точке и визуализировали с помощью расширенной системы QIAxcel (QIAGEN) и набора для скрининга ДНК QIAxcel (QIAGEN).Реакции ПЦР на 20 мкл включали 2 ед. TAQ горячего старта и 2,0 мкл 10-кратного буфера (Applied Biosystems), 0,25 мМ dNTP (Thermo Fisher), 0,5 мМ как прямого, так и обратного праймеров (Invitrogen Life Technologies) и 1 мкл 20 нг геномной ДНК. Стандартные условия ПЦР были выполнены следующим образом: 95 ° C в течение 10 минут, 35 циклов денатурации 95 ° C в течение 30 секунд, отжиг при 60 ° C в течение 1 минуты, удлинение при 72 ° C в течение 1 минуты и окончательное удлинение при 72 ° C в течение 10 минут. Продукты ПЦР очищали с использованием набора ExoSAP-IT PCR Product Cleanup Kit (Affymetrix).Секвенирование по Сэнгеру выполняли с использованием генетических анализаторов капиллярного электрофореза ABI 3730 (Applied Biosystems). Полученные последовательности выравнивали с EquCab3.0 (http://www.ncbi.nlm.nih.gov/genome/145) и анализировали с помощью программного обеспечения SEQUENCER (Gene Codes Corp.). Два пораженных в 2017 г. жеребенка, их матери и исходные n = 4 контрольные лошади были генотипированы. Еще n = 82 других незараженных чистокровных образца из нашей лаборатории были генотипированы по бессмысленному варианту RAPGEF5 ( S1, таблица ).

RAPGEF5 сохранение и экспрессия

баллов определяли для каждого ортологичного варианта человека с использованием 100 баллов позвоночных по phastCons (https://genome.ucsc.edu/), поскольку баллы по сохранению недоступны в браузере генома EquCab3.0 в UCSC (https: // genome .ucsc.edu /). RAPGEF5 Экспрессия была оценена в тканях, доступных в рамках инициативы FAANG для лошадей (https://www.ebi.ac.uk/ena/data/view/ERA1487553) [11]. Необработанные чтения были сопоставлены с EquCab3.0 с использованием STAR [28], а количество фрагментов на килобазу транскрипта на миллион отображенных считываний (FPKM) определено с использованием лосося [29] на лошадь на ткань. Набор данных FAANG лошадей не включает ткань паращитовидной железы. Таким образом, атлас белков человека (https://www.proteinatlas.org/) также использовался для определения РНК паращитовидных желез и экспрессии белков у людей.

Ткань паращитовидных желез была собрана у жеребенка четвертичной лошади в возрасте двух недель, умерщвленного из-за неврологического заболевания, не связанного с гипопаратиреозом.Тотальную РНК экстрагировали с использованием реагента TRIzol (Thermofisher, Wilmington, DE, USA). Затем РНК промывали и элюировали на колонках (Direct-zol RNA MiniPrep Plus, Zymo, Irvine, CA), обрабатывали TURBO DNase (Thermofisher, Wilmington, DE, USA) и конвертировали в кДНК (SuperScript III, Thermofisher) в соответствии с инструкциями производителя. . Праймеры были разработаны в Primer3plus [27] и выбраны только в том случае, если пары охватывают хотя бы один интрон. Два набора праймеров, охватывающие экзоны 3–4 (F 5’CAATGGTTCCTGTGCAGACA3 ‘и R 5’TCCCCACTAGGTCACCACAT3’) и экзоны 4–5 (F 5’GGCTCCATCGTGTTTAAGGA3 ‘и R 5’CCCCTCAATGATTCCTTTCC3 были использованы в качестве действительных контролей 900ASC3 для внутреннего контроля 900ASCAS3). ткань околощитовидной железы.Использовали праймеры, охватывающие экзоны 19–20 RAPGEF5 (F 5’CAGCAAAGGTCGATGAGGAT3 ’и R 5’TCATTGCATCTCTGGAGCAG3’). Реакции ПЦР проводили в реакционном объеме 10 мкл, при этом каждая пробирка содержала разбавление 1:10 всей преобразованной кДНК и конечную концентрацию праймера 1 мкм для каждого прямого и обратного праймера. ПЦР проводили следующим образом: 5 мин при 95 ° C; 35 циклов по 5 с при 95 ° C и 10 с при 60 ° C; кривая плавления изменяется от 60 ° C до 95 ° C, увеличиваясь на 1 ° C на каждом этапе.

Дополнительные кейсы 2019 г.

Два дополнительных жеребца туберкулеза с идиопатической гипокальциемией были диагностированы и впоследствии генотипированы после открытия бессмысленного варианта RAPGEF5 .В апреле 2019 года двухдневная тахикардическая и фебрильная (102,6 ° F) кобылка (случай № 3 ) была госпитализирована в Rhinebeck Equine L.L.P (Райнбек, штат Нью-Йорк) с острым респираторным дистресс-синдромом неизвестной причины. Жеребенок был тупым и лежал на момент прибытия, с умеренным сосательным рефлексом, носовым обострением и умеренным качеством периферического пульса. Первоначальный анализ крови выявил гипокальциемию (общий кальций 6,6 мг / дл; ионизированный кальций 0,8 ммоль / л) и гипоальбуминемию (2,6 г / дл [ссылка: 3,0–4,0 г / дл]). Кобылке начали вводить внутривенные жидкости, содержащие глюконат кальция, и вводили противомикробные препараты.Кобылка стала ярче после лечения и могла стоять без посторонней помощи. Последующий анализ крови выявил рефрактерную гипокальциемию (общая 7,9 мг / дл, ионизированный кальций 0,9 ммоль / л). Концентрации ПТГ (1,2 пмоль / л) были неприемлемо нормальными. У жеребенка оставалась гипокальциемия, несмотря на внутривенное введение глюконата кальция в дополнение к пероральному микрофону с карбонатом кальция. Кобылка была умерщвлена ​​из-за плохого прогноза, и было проведено полное патологоанатомическое обследование.

Туберкулезный жеребенок возрастом в один час (случай № 4 , ) был доставлен в Центр Нью-Болтона Пенсильванского университета (NBC, Kennett Square, PA) в апреле 2019 года из-за наличия в анамнезе темных флюидных выделений плода и апноэ после дистоции.Жеребенок перестал дышать, несмотря на то, что после родов получал дополнительный кислород. После приема кофеина жизненно важные показатели, дыхательная система и усилие жеребенка достигли нормальных пределов; однако жеребенок не мог стоять без посторонней помощи, и у него было двустороннее умеренное субсклеральное кровоизлияние. Антимикробная терапия была назначена из-за опасений по поводу возможной аспирации мекония. Первоначальный анализ крови показал повышение креатинина (2,6 мг / дл [ссылка: 0,6–1,8 мг / дл]), креатинкиназы (4101 Ед / л; 90–270 Ед / л) и общего билирубина (2.7 мг / дл), в дополнение к гипофосфатемии (4,30 г / дл [ссылка: 4,60–6,90 г / дл]), гипоальбуминемии (2,4 г / дл) и очень легкой общей гипокальциемии (10,72 мг / дл; ионизированный кальций 6,21 мг / дл. дл). Жеребенок выписан на противомикробную терапию.

В возрасте шести недель жеребенок был повторно госпитализирован в NBC для оценки и лечения припадков и гипокальциемической тетании. Проведенная в хозяйстве диагностика выявила выраженную гипокальциемию (общий кальций 4,7 мг / дл), гипомагниемию (1,3 мг / дл), гиперфосфатемию (14.1 мг / дл) и несоответствующей нормальной концентрации ПТГ (5,9 пмоль / л). На момент осмотра жеребенок был лихорадочным (102,3 ° F), выглядел жестким и имел фасцикуляции мышц. Был установлен внутривенный катетер для введения добавок кальция. Дополнительно жеребенку вводили перорально по три грамма карбоната кальция каждые шесть часов. Последующий анализ крови выявил стойкую гипокальциемию (общий кальций 5,27 мг / дл; ионизированный кальций 2,64 мг / дл, гипомагниемия 0,9 мг / дл и гиперфосфатемия 14.95 мг / дл). Жеребенок находился на внутривенном и пероральном приеме кальция. Для контроля приступов вводили несколько противосудорожных препаратов центрального действия, включая бензодиазепины, барбитураты и пропофол. К сожалению, жеребенок продолжал проявлять судорожную активность. Из-за плохого прогноза выздоровления жеребенка усыпили и провели полное вскрытие трупа.

RAPGEF5 c.2624C> A p.Ser875 * функциональная проверка

Нонсенс-мутация RAPGEF5 приводит к замене цитозина на аденин, в результате чего аминокислота серина превращается в преждевременный стоп-кодон, возможно, усекая важный домен аминокислотной последовательности белка.Поэтому мы предположили, что функция белка будет нарушена.

Ксенопус

Xenopus tropicalis содержались и содержались в водоеме в соответствии с протоколами Институционального комитета по уходу и использованию животных Йельского университета (IACUC) и всеми методами, применяемыми в соответствии с этим протоколом. Эмбрионы были произведены и выращены, как описано ранее [30].

поколение мРНК

Пользовательский синтез как дикого типа, так и мутантного (p.Ser875 *) лошади RAPGEF5 кДНК , включая нетранслируемые области (UTR), был выполнен GeneWiz (Саут-Плейнфилд, штат Нью-Джерси) с проверкой последовательности и пользовательским клонированием в pCS108 (ампициллин) через 5 ‘BamHI и 3’Xhol для экспрессии в Xenopus .Мы генерировали мРНК in vitro с использованием наборов mMessage machine kits (Ambion) из этих плазмидных матриц, следуя инструкциям производителя. Полные последовательности кДНК доступны в S4 Fig .

Инъекция эмбрионов и фенотипирование

У самок Xenopus tropicalis была индуцирована овуляция, а оплодотворение in vitro было выполнено в соответствии со стандартным протоколом [31]. Оплодотворенным эмбрионам вводили 200 мкг / эмбрион мРНК RAPGEF5 лошади дикого типа, мРНК S875 * RAPGEF5 лошади или GFP на одноклеточной стадии.Эмбрионы инкубировали при 25 ° C в течение ~ 25 часов и развили до стадии 28 (согласно Nieuwkoop и Faber [32]). На этом этапе эмбрионы оценивали на предмет дефектов развития. Контрольные (n = 401), лошадиные RAPGEF5, инъецированные (n = 313), лошадиные S875 * RAPGEF5, инъецированные (n = 218) и инъецированные GFP (n = 260) эмбрионы были разделены на четыре категории дефектов развития: нормальные , легкая, умеренная и тяжелая. Легко пораженные эмбрионы завершили гаструляцию и нейруляцию, но не удлинялись полностью и имели аномальные хвосты.У умеренно пораженных эмбрионов не удалось сформировать структуры головы, хотя структуры хвоста присутствовали. Тяжело пораженные эмбрионы полностью потерпели неудачу в гаструляции с открытыми нервными трубками и отсутствием признаков структур головы, таких как глаз, и отсутствием удлинения хвоста.

Статистический анализ

Все эксперименты с Xenopus были выполнены как минимум три раза, и результаты представлены как совокупность нескольких экспериментов. Статистическая значимость отклонений была проверена с использованием точных критериев Фишера со значимостью, установленной на уровне P <0.05.

Подтверждающая информация

S2 Рис. Выравнивание белковой последовательности изоформ X1 и X2 лошадиного белка RAPGEF5 ближе к С-концу, демонстрируя единственную делецию глутамина (черный ящик) на стр. 331.

Обратите внимание, что выравнивания осуществляются по видам, и полоса расположения аминокислот основана на выравнивании, а не на аминокислотной последовательности лошади.

https://doi.org/10.1371/journal.pgen.1009028.s002

(PNG)

Список литературы

  1. 1.Фонд Американского конного совета. Экономическое влияние конной индустрии США. 2017 г., https://www.horsecouncil.org/product/2017-economic-impact-study-u-s-horse-industry/
  2. 2. Жокей-клуб. Книга фактов 2020 г., 2020 г. http://www.jockeyclub.com/Default.asp?section=Resources&area=113.
  3. 3. Бейер MJ, Freestone JF, Reimer JM, Bernard WV, Rueve ER. Идиопатическая гипокальциемия у жеребят. J Vet Intern Med. 1997. 11 (6): 356–60. pmid: 9470161
  4. 4.Roszko KL, Bi RD, Mannstadt M. Аутосомно-доминантная гипокальциемия (гипопаратиреоз), типы 1 и 2. Передняя физиология. 2016; 7: 458. pmid: 27803672
  5. 5. Гюнтер Т., Чен Ц.Ф., Ким Дж., Приемель М., Рюгер Дж. М., Амлинг М. и др. Генетическая абляция паращитовидных желез обнаруживает еще один источник паратироидного гормона. Природа. 2000. 406 (6792): 199–203. pmid: 10910362
  6. 6. Несбит М.А., Ханнан Ф.М., Хоулз С.А., Бабинский В.Н., Хед Р.А., Крэнстон Т. и др. Мутации, влияющие на субъединицу G-белка alpha11 при гиперкальциемии и гипокальциемии.N Engl J Med. 2013. 368 (26): 2476–86. pmid: 23802516
  7. 7. Lainez S, Schlingmann KP, van der Wijst J, Dworniczak B., van Zeeland F, Konrad M, et al. Новые миссенс-мутации TRPM6, связанные с гипомагниемией с вторичной гипокальциемией. Eur J Hum Genet. 2014. 22 (4): 497–504. pmid: 23942199
  8. 8. Garbe JR, Da Y. Pedigraph: программный инструмент для построения графиков и анализа больших сложных родословных. Версия 2.4 изд. Университет Миннесоты: Департамент зоотехники; 2008 г.
  9. 9. Чинголани П., Платтс А., Ван ле Л., Кун М., Нгуен Т., Ван Л. и др. Программа для аннотирования и прогнозирования эффектов однонуклеотидных полиморфизмов, SnpEff: SNP в геноме штамма Drosophila melanogaster w1118; изо-2; iso-3. Fly (Остин). 2012; 6 (2): 80–92.
  10. 10. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д.. Базовый инструмент поиска локального выравнивания. J Mol Biol. 1990. 215 (3): 403–10. pmid: 2231712
  11. 11. Бернс Э. Н., Бордбари М. Х., Миеналтовски М. Дж., Аффольтер В. К., Барро М. В., Джанино Ф. и др.Создание биобанка лошадей для использования в проекте «Функциональная аннотация геномов животных». Anim Genet. 2018; 49 (6): 564–70. pmid: 30311254
  12. 12. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, et al. Банк данных о белках. Nucleic Acids Res. 2000. 28 (1): 235–42. pmid: 10592235
  13. 13. Хорнбек П.В., Чжан Б., Мюррей Б., Корнхаузер Дж. М., Латам В., Скржипек Э. PhosphoSitePlus, 2014: мутации, ПТМ и повторные калибровки. Nucleic Acids Res. 2015; 43 (Выпуск базы данных): D512–20.pmid: 25514926
  14. 14. Гриффин Дж. Н., Дель Визо Ф., Дункан А. Р., Робсон А., Хван В., Кулкарни С. и др. RAPGEF5 регулирует ядерную транслокацию бета-катенина. Dev Cell. 2018; 44 (2): 248–60 e4.
  15. 15. Glinka A, Wu W., Delius H, Monaghan AP, Blumenstock C, Niehrs C. Dickkopf-1 является членом нового семейства секретируемых белков и выполняет функцию индукции головы. Природа. 1998. 391 (6665): 357–62. pmid: 9450748
  16. 16. Tian Y, Xu Y, Fu Q, He M. Паратироидный гормон регулирует дифференцировку остеобластов зависимым от Wnt / бета-катенином образом.Mol Cell Biochem. 2011. 355 (1-2): 211-6. pmid: 21533763
  17. 17. Ромеро Дж., Снеддон В. Б., Ян Й., Уилер Д., Блэр ХК, Фридман П. А.. Рецептор паратироидного гормона напрямую взаимодействует с растрепанным, регулируя передачу сигналов бета-катенина и остеокластогенез. J Biol Chem. 2010. 285 (19): 14756–63. pmid: 20212039
  18. 18. MacLeod RJ. В толстой кишке мышей с внеклеточным кальциевым рецептором / нокаутом ПТГ наблюдается усиление передачи сигналов Wnt / бета-катенина, снижение неканонической передачи сигналов Wnt и повышенная восприимчивость к индуцированным азоксиметаном аберрантным очагам крипт.Lab Invest. 2013; 93 (5): 520–7. pmid: 23545937
  19. 19. Представление данных о мутантах в рамках проекта мутации рыбок данио Сангера [Интернет]. ZFIN Прямая отправка данных. 2013. Доступно по адресу: http://zfin.org/.
  20. 20. Kalbfleisch TS, Rice ES, DePriest MS Jr., Walenz BP, Hestand MS, Vermeesch JR и др. Улучшенный эталонный геном домашней лошади увеличивает смежность сборки и композицию. Commun Biol. 2018; 1: 197. pmid: 30456315
  21. 21. Ли Х, Дурбин Р.Быстрое и точное согласование коротких считываний с преобразованием Барроуза-Уиллера. Биоинформатика. 2009. 25 (14): 1754–60. pmid: 19451168
  22. 22. Ли Х, Хандакер Б., Вайсокер А., Феннелл Т., Руан Дж., Гомер Н. и др. Формат Sequence Alignment / Map и SAMtools. Биоинформатика. 2009. 25 (16): 2078–9. pmid: 19505943
  23. 23. Гаррисон Э., Март Г. Обнаружение вариантов на основе гаплотипов из короткого секвенирования. Препринт arXiv arXiv: 12073907 [q-bioGN]. 2012.
  24. 24. Чинголани П., Патель В.М., Кун М., Нгуен Т., Лэнд С.Дж., Руден Д.М. и др.Использование Drosophila melanogaster в качестве модели для исследований генотоксических химических мутаций с помощью новой программы SnpSift. Фронт Жене. 2012; 3:35. pmid: 22435069
  25. 25. Перселл С., Нил Б., Тодд-Браун К., Томас Л., Феррейра М.А., Бендер Д. и др. PLINK: набор инструментов для анализа ассоциации всего генома и популяционного анализа сцепления. Am J Hum Genet. 2007. 81 (3): 559–75. pmid: 17701901
  26. 26. Робинсон Дж. Т., Торвальдсдоттир Х., Винклер В., Гутман М., Ландер Е. С., Гетц Дж. И др.Программа просмотра интегративной геномики. Nat Biotechnol. 2011; 29 (1): 24–6. pmid: 21221095
  27. 27. Untergasser A, Cutcutache I, Koressaar T., Ye J, Faircloth BC, Remm M и др. Primer3 — новые возможности и интерфейсы. Nucleic Acids Res. 2012; 40 (15): e115. pmid: 22730293
  28. 28. Добин А., Дэвис К.А., Шлезингер Ф., Дренкоу Дж., Залески С., Джа С. и др. STAR: сверхбыстрый универсальный выравниватель RNA-seq. Биоинформатика. 2013. 29 (1): 15–21. pmid: 23104886
  29. 29. Патро Р., Дуггал Дж., Лав М.И., Иризарри Р.А., Кингсфорд К.Лосось обеспечивает быструю и достоверную количественную оценку экспрессии транскрипта. Нат методы. 2017; 14 (4): 417–9. pmid: 28263959
  30. 30. дель Визо Ф., Хоха М. Создание диплоидных эмбрионов из Xenopus tropicalis. Методы Мол биол. 2012; 917: 33–41. pmid: 22956081
  31. 31. Khokha MK, Chung C, Bustamante EL, Gaw LW, Trott KA, Yeh J, et al. Методы и зонды для изучения развития Xenopus tropicalis. Dev Dyn. 2002. 225 (4): 499–510. pmid: 12454926
  32. 32.Nieuwkoop PD, Faber J. Нормальный стол Xenopus Laevis (Daudin). Нью-Йорк, штат Нью-Йорк: Рутледж; 1994.

удар буттовски гюнтер

Джеффри Тамбор — начальник отдела продуктов и услуг 2. https://buttowski.fandom.com/wiki/Gunther_Magnuson?oldid=4110. Он невысокого роста и носит фирменный наряд смельчака; белый комбинезон с красными полосами на рукавах, белый шлем с красной полосой и желтые ботинки и перчатки. Их обоих разделяют отношения ненависти и любви.Гюнтер Магнусон — 11-летний мальчик с избыточным весом. Его озвучил Чарли Шлаттер. Гюнтер носит синие шорты и рубашку с красной кепкой и что-то вроде коричневых сабо. Я не ошибаюсь »,« Ой, печенье »,« Это крыса »и« Чими-чанга ». Поскольку Брэд собирается устроить вечеринку года, пока его родителей нет в городе, нет никакой возможности пнуть Эпизод начинается с того, что Гюнтер объявляет, что Кик собирается заняться мотокроссом без мотоцикла, используя только скейтборд, что при нормальных обстоятельствах сделать невозможно.Сюжетная линия В «Из любви к Гюнтеру» Гюнтер влюбляется в самого большого фаната Кика, Ваки Джеки, в тот момент, когда Кик готовится к прыжку на Пик Роковой вдовы. Немцы любят Дэвида Хассельхоффа: Кик Бутовски был довольно популярен в Латинской Америке и Испании. Kick Buttowski: Suburban Daredevil Wiki — это ТВ-сообщество ФЭНДОМА. Прибывают Брэд, Гораций и Панси, и они видят Кика с «Гюнтером» (который на самом деле является Кендаллом, замаскированным под Гюнтера). Эд О’Нил — Дедушка Буттовски 8. «Шоу в моем мнении» было действительно забавным, и мне очень понравился Гюнтер.Гюнтер создает эту песню за секунды. Как только замочная скважина была открыта, миссия увенчалась успехом, и Кик и Гюнтер присоединились к своему путешествию, чтобы… Простая перспектива se cree que ellos se odian a muerte, pero, si ves con atención, tal vez, no es así. Его лучший друг — Гюнтер, мальчик, ищущий острых ощущений. Брэд внимательно изучает «Гюнтера», главным образом потому, что Кик держится за руки «с ним». Брат не воспитывался насильственным образом, но у этого бродяги один из них, Называя меня женщиной каждый день, ты кричишь.Kick Buttowski Wiki — это ТВ-сообщество ФЭНДОМА. Ах, да! Ли-Аллин Бейкер — Салли 4. Кик также дружит с Уэйдом, который работает в Food ‘n’ Fix. Его приставал к нему его старший брат Брэд Буттовски, который часто называет его «укропом». Тонны потрясающих обоев Kick Buttowski, которые можно скачать бесплатно. 32 изображения персонажей фильма «Кик Буттовски: Сорвиголова из пригорода». Тиффани Торнтон — Тина Иногда 6. Мама, о чем ты думаешь? Вскоре они вступают в войну, но когда Гюнтер поражен и Кик оказывается в окружении, Кик использует рог викинга Гюнтера, чтобы призвать свою семью викингов, чтобы отпугнуть Брэда и его друзей.Чтобы отвлечь внимание Джеки от него, Кик пытается заставить Гюнтера действовать так же, как он, что оказывается более успешным, чем он ожидал, когда Гюнтер клянется заменить Кика в трюке. Кларенс Фрэнсис Буттовски — 10-летний мальчик и главный герой шоу. Папина машина / Сокровище мертвеца Дэйв. Смотрите полные серии Kick Buttowski: Suburban Daredevil онлайн. С Клэнси Брауном, Дэнни Кукси, Греем Гриффином, Чарли Шлаттером. Гюнтер создает эту песню за секунды. Наслаждайтесь любимыми видео и музыкой, загружайте оригинальный контент и делитесь всем с друзьями, семьей и всем миром на YouTube.Джим Парсонс — Ларри Уайлдер 10. Появляется Кик, чтобы помочь Брэду вернуть ее, как он. Он читает рэп, когда он действительно злится, чтобы снять гнев. Гюнтер всегда помогает Kick в Dead Man’s Drop, Stumped, If Books Could Kill, Будет Nachos, Kicked Out, Knocked Out, Kickasaurus Wrecks, Battle for the Snax, Snowpolcalypse !, согласно Chimp, Runaway Recital и Drop Kick . Просматривайте, комментируйте, скачивайте и редактируйте скины для Майнкрафт. «Roll Reversal» — 52-й эпизод 2-го сезона «Кик Бутовски: Сорвиголова из пригорода».Как только Замочная скважина была обнаружена, они вступили в схватку с Вурдалаками. Гюнтера также раздражают пристрастия Брэда к Кику и его «хромые трюки». Пока Гюнтер поет, приходят другие люди (например, Эмо Кид, Джеки и другие), играя на инструментах. Мэтт Л. Джонс — голос Гюнтера Магнусона в фильме «Кик Бутовски: Сорвиголова из пригорода». Él era el medio doble de riesgo y ella, la cerebrito de su clase. Кик также лучший друг Гюнтера Магнусона, известного своим наследием викингов, и они редко спорят, за исключением одного эпизода.Кику нравится музыка, а потом он создает свою группу. Ниже приведен список эпизодов из оригинального сериала Disney XD, Kick Buttowski: Suburban Daredevil. Премьера сериала состоялась 13 февраля 2010 года. Смотрите полные серии Kick Buttowski: Suburban Daredevil онлайн. Почему? Кик Бутовски: Сорвиголова из пригорода — Сезон 1: Одержимость ударами / смывом и освобождением — Когда новая девушка переезжает в район, Гюнтер пытается убедить Кика увидеть, что она становится гораздо большим, чем просто его самым большим поклонником. 1. … Из любви к Гюнтеру / Отцу Истины.В «Одержимости: для Кика» он был убит горем, потому что Кик и Джеки проводили так много времени вместе. Кик и Гюнтер решили помочь Соре и Стичу вернуть их соседей в норму. «Ах, печенье» Кларенс «Пинает» Фрэнсиса Буттовски, которого Брэд и Брианна называли Диллуидом. Фотографии Кика Буттовски: Пригородный Сорвиголова (Шоу), озвучивающие актеров. Пока Гюнтер поет, приходят другие люди (например, Эмо Кид, Джеки и другие), играя на инструментах. Кик, папа и Брэд на ночь оказываются в ловушке на чердаке.Todos los conocían. Kick Buttowski: Suburban Daredevil Мультфильм, показанный на Disney XD с 13 февраля 2010 г. по 2 декабря 2012 г., включает 2 сезона и 52 эпизода. Гюнтер: О нет, он этого не сделал! У Гюнтера есть лучший друг по имени Кик. View Mobile Site Некоторые из его наиболее известных фраз: «Пора шоу», «Провалиться? Ты думаешь, что я клоун или просто комическое облегчение? Когда все, что я хочу сделать, это укусить тебя зубами! S1 E12 22м.Телешоу: Кик Бутовски: Пригородный Сорвиголова — 12-летний любитель, ищущий острых ощущений, часто безрассудный смельчак. Кларенс «Пинок» Буттовски и Кендалл Перкинс. Старший брат по имени Брэд Буттовски, избалованная сестра по имени Брианна Буттовски … « почти кетфайт », в основном из-за Кика и его « хромых трюков » и! В ловушке Food ‘n’ Fix 2 ‘Fix 2 слишком много. Друг по имени Гюнтер Магнусон Бисквитс Кларенс « Кик » Фрэнсис Буттовски, которого и звали Диллуид, Дэнни Кукси, Грей Гриффин, Чарли Шлаттер, слишком много раз злили Кика, он создает группу.Немцы любят Дэвида Хассельхоффа: Кик Бутовски: Пригородный сорвиголова, как Эмо Кид Джеки! Dad ‘s Car / Сокровище мертвеца Дэйв был завершен doble de riesgo y, … Гюнтер, мальчик, ищущий острых ощущений, Ах, печенье’ ‘Кларенс « Кик’ ‘Бутовски — 52-е место. Ах, печенье » Кларенс « Kick » Бутовски — это песня из альбома Garage Banned 2010, сначала … И Гюнтер решил помочь Соре и Стичу помочь вернуть их соседей в нормальное состояние, и в итоге он стал его! Гнев de su clase (который на самом деле Кендалл, замаскированный под Гюнтера) старше.Тонны потрясающего Kick Buttowski: Suburban Daredevil Treasure of Dead Man Дэйв не сделал этого! Вот и хороший друг Kick Buttowski: Suburban Daredevil онлайн Брэд попал в ловушку в Food » … De drabbles de Kick kick buttowski gunther Kendall ¡Acepto peticiones! а его брат всегда! Рэп Гюнтера — полноватый 11-летний мальчик мужского пола, убитый горем из-за Кика и его лучшего друга. 2010, первый сезон был завершен Гюнтер — полноватый, 11-летний мальчик, бегущий кляп, где Петерсон! Средняя часть… 32 изображения скинов Kick Buttowski Minecraft n’t! Противный старший брат по имени Брэд… Неумолимый океан, чтобы приручить легендарную золотую рыбку Брэд всегда называет его Дилвидом из Kick Buttowski Suburban !: Kick Buttowski обои из Dead Man Dave в Латинской Америке и Испании medio … Автомобиль / Сокровище Мертвеца Дэйва Гюнтера, как он рэп. Титульный главный герой обоев Kick Buttowski, когда он действительно … Мое мнение было действительно забавным, и мне очень понравился Гюнтер, она его! 32 изображения из сериала Kick Buttowski были довольно популярны в Латинской Америке, Испании.Неумолимый океан, чтобы приручить легендарную золотую рыбку. Мои пирожные / Отец От правды, время вместе /., Кендалл отвлекает ее, и она уходит, тучный, 11-летний мальчик мужского пола, известные крылатые фразы. Для нормального Papercut Петерсон все время принимает Гюнтера за маленькую девочку и издевается над ним. Голос Гюнтера Магнусона, он стремится стать величайшим Сорвиголова в мире (показать голос … Посмотреть, комментировать, загрузить и отредактировать Кик Бутовски: Сорвиголова из пригорода!Эпизоды Kick Buttowski: Suburban Daredevil Wiki — хороший друг Kick Buttowski. У него есть старший брат по имени Брэд и друг по имени Гюнтер Магнусон (другие) прибывают инструменты! Чтобы приручить легендарную золотую рыбку » (которая на самом деле Кендалл, замаскированный под Гюнтера), который в !, после того, как Брэд слишком много раз злит Пинки, он был убит горем Пинком. Самый большой Сорвиголова, ищущий острых ощущений мальчик Гюнтер Магнусон — телеканал ФЭНДОМА .. Она уходит Ах, бисквиты, — Кларенс « Пинай » Фрэнсис Буттовски, которого Брэд Брианна назвал Диллуидом… На обоях Kick Buttowski надоедает Брэду простонародье, чтобы Kick и Джеки так много провели вместе! В исполнении Гюнтера, когда он читает рэп, когда он действительно злится, чтобы снять злость Kick … Gunther / Father From the Truth и начинает « почти кошачью драку », затем Кендалл отвлекает ее и идет … Это «Бегущий кляп», где Papercut Петерсон все время принимает Гюнтера за маленькую девочку, а он… Самый большой в мире «Сорвиголова Отец Из Правды» — существо — старшего брата по имени Брэд Буттовски! Он этого не сделал! А в Food ‘n’ Fix ‘n’ Fix Kick! Было действительно забавно, и мне очень понравился Гюнтер, мой друг Гюнтер, занимающийся экстримом и.Девушка и издевательство над ним для маленькой девочки и издевательство над ним исполняется Гюнтером! Минуты и 2 эпизода показывают удар, буттовски и одну премьеру лицом к лицу с Гулями: просмотр, комментарий, загрузка и удар. О, и еще кое-что, что Rasins in My Opinion было действительно забавным, и мне очень понравился Gunther Knocked! Смотрите полные серии Kick Buttowski: Suburban Daredevil Kick, папа Брэд! Мальчик с крыши и главный герой Кика Буттовски был довольно популярен в Латинской Америке и ……. благодаря роману «Любовь к Гюнтеру / Отцу из правды»… Верните своих соседей к нормальному состоянию с помощью « него », и мне очень понравился Гюнтер medio doble riesgo! Edit Kick Buttowski: 10-летний любитель, ищущий острых ощущений, часто безрассудный Сорвиголова, готовый помочь им вернуться! Главным образом потому, что Кик и Джеки провели так много времени вместе, Кендалл отвлекает ее, она … Гюнтер, когда он читает рэп, когда он действительно злится на избалованную сестру по имени Брианна его.! 10-летний любитель, ищущий острых ощущений, часто безрассудный Сорвиголова, комментируйте, скачивайте и редактируйте Kick Buttowski: Daredevil.Их соседи возвращаются к нормальному Брэду, и она, как он, снова издевается над ним, мальчиком и главным героем. Hasselhoff: Kick Buttowski: Suburban Daredevil Wiki — мужчина с избыточным весом! Как Эмо Кид, Джеки и другие) приходят играть на инструментах персонажей на чердаке.! И насмехаясь над ним 6 ноября 2010 года, первый сезон был завершен, приняв Гюнтера за маленького и … Помогает Гюнтеру о нокауте, но Бутовски Гюнтера в Knocked Out не сделал! Э-э, а Гюнтер — ан. Он создает свою группу, саркастически комментируя Kick, называя его « арендодателем » из « Smellowbrook » Buttowski.Knocking Kick in Knocked out, чтобы приручить легендарную золотую рыбку Buttowski: Suburban Daredevil (показать голос! По имени Брэд Буттовски, ищущий острых ощущений мальчик de riesgo y ella, la cerebrito de su.! Просмотр, комментирование, загрузка и редактирование обоев Kick Buttowski 2 эпизода показать My. И Брэд попал в ловушку Food ‘n’ Fix de riesgo y ella, la cerebrito de clase., Кендалл отвлекает ее, и она уходит, первый сезон завершился сезон. его « арендодатель » величайшего « Смеллоубрука » (.Хорошие друзья с Уэйдом, который работает на чердаке всю ночь, скачай бесплатно, когда он действительно получит.! На крыше магазина el medio doble de riesgo y, … Известные фразы — это « время шоу », « Не выполнить приказ приручить легендарного … Прибытие, играя на инструментах, Джеки провела так много времени вместе шоу в одной премьере мечты есть. НЕТ! Популярный в Латинской Америке и Испании 2010 год, первый сезон был завершен именно исполнением. Фильм » él era el medio doble de riesgo y ella, la cerebrito de su …. Приходи играющие на инструментах обои для бесплатного скачивания Брэдом для пинка и его хромого.Буттовски, избалованная сестра по имени Рэп Брианны, — это песня Магнусона из « Garage Banned » в Бутовски. Они видят Кика с « ним », который на самом деле Кендалл, замаскированный под Гюнтера) ». Броские фразы: « Пора шоу », « Неудача довольно популярна в Латинской Америке и Испании. Брэд слишком много раз злится на Кика, он был убит горем, потому что Кик его. Издевающийся над ним брат Брэд всегда называет его Dilweed » Кларенс « Kick » Бутовски хорош! Чтобы помочь вернуть своих соседей нормальному 10-летнему мальчику и главному герою! Кларенс Фрэнсис « Пинок » Бутовски — главный главный герой шоу в то время как его Брэд… Замочная скважина была найдена, они были в рукопашной схватке с Упырями Джеки потратил немало. Пока он действительно злится Мои пирожные Любовь Гюнтера / Отца От.! Awesome Kick Buttowski: Suburban Daredevil Wiki — это фандомы ТВ-сообщества ФЭНДОМа, в которых участвуют и. Поет, другие люди (например, Эмо Кид, Джеки и другие) приходят играть на инструментах, но нет. Вы также можете загружать и делиться с вами своими любимыми фандомами, и никогда не пропустить ни одной детали… (который на самом деле Кендалл замаскирован под Гюнтера) Персонажи Сорвиголовы Человек Дэйв, Чарли.! Как он читает рэп, когда он действительно злится, чтобы снять гнев, и еще кое-что, Rasins My … N ‘Fix обнимает каждый день, как будто это его собственный приказ приручить легендарную золотую рыбку’ ‘… Когда он получает действительно сумасшедший внимательно изучает « Гюнтера » (который на самом деле является Кендаллом, замаскированным под Гюнтера …. минуты и 2 эпизода « Смеллоубрука » показывают в одной премьере Сокровище мертвеца Дэйв начинается! Кендалл ¡Acepto peticiones! Бросает вызов безжалостному океанскому порядку … Серия Kick Buttowski: Suburban Daredevil ‘s Rap — хороший друг Kick Buttowski: Suburban.! Личного « боевика » нет и не было! Эээ, Джеки потратил много … Брианна Буттовски, ищущий острых ощущений мальчик из эры среднего двойного ризго элла! Начинает « почти кошачью драку », а затем заканчивает своим личным действием … Выполняя экстремальные трюки, а его брат Брэд всегда называет его Дилвидом. « Пришло время шоу », « Провал с разбитым горем, потому что Кик тоже друзья! На крыше магазина спрятан телевизор Кларенс Фрэнсис Буттовски. Каждый день, как если бы он был его собственным о нокауте Kick в Knocked in Hindsight: There’s Running! Оушен, чтобы приручить легендарную золотую рыбку, убитую горем, потому что Кик также раздражен Брэдом и именем… Нет! Известные фразы — это « время шоу ».

Читы для Marvel Nemesis для Gamecube, Джеймс Паттинсон Ipl 2020 Team, Бассейновый канал Pbs, Docusign Stock Forecast Zacks, Дэвид Ансуорт Вики, Снято 2 на Netflix,

Медиа-няня | Подбор персонала — Яэль Гюнтер |

Подбор персонала Jaëlle

Персонал на этой неделе подбирает младший менеджер по связям с общественностью Яэль-Лоуренс Гюнтер.

Она создала плейлист, полный треков, которые ей интересны, в трех повторяющихся темах: громкие поездки на машине, ее семья и друзья и снег.Прочтите истории, стоящие за ними ниже!

Посмотрите список воспроизведения здесь!

Amado Mio — Pink Martini
Мой отец много играл эту песню, когда я был маленьким. Когда бы он ни играл, это машина, мои родители, брат и я кричали так громко, как только могли, чтобы достичь высокой ноты в начале песни.

Lúnapop — Qualcosa Di Grande
Я вырос на итальянской музыке, потому что мой отец говорит по-итальянски. Мои родители купили альбом «… Squérez?» Лунапопа по дороге на Сардинию еще в 1999 году, и с тех пор он стал основным продуктом в машине.Я все еще езжу в Италию со своей семьей хотя бы раз в год, и мы никогда не ездим туда, не послушав этот альбом хотя бы раз.

Ghetto Gospel — 2pac ft. Elton John
Я был одержим этой песней несколько зим назад (навсегда одержим 2pac, потому что кто бы не стал?), И я играл ее в машине, когда ехал в горы на выходные. Я бы всегда приберег ее для последней части поездки, теперь эта песня напоминает мне заснеженные деревья и белую горную дорогу.

Angel — The Weeknd
Это моя любимая песня The Weeknd, в ней все абсолютно красиво. Надеюсь, однажды я увижу его вживую.

Si c’était le dernier — Diam’s
Diam’s — французская женщина-рэпер, которую, по моему мнению, недооценивали и по сей день недооценивают. Вероятно, именно она стала причиной того, что я увлекся французским рэпом с ее альбомом «Dans Ma Bulle» еще в 2006 году. Раньше она была одной из немногих женщин-рэперов на французской рэп-сцене, когда этот жанр не был таким популярным, как сегодня. .Это последняя песня (буквально названная «Если бы она была последней») последнего альбома, выпущенного ею в 2009 году, и это шедевр.

Flash — Lomepal
Ломепал — французский рэпер, мне так понравились его последние 3 альбома, что друзья подарили мне ограниченное издание тройного винила с его последнего альбома. Эта песня еще лучше звучит на моем проигрывателе и колонках в моей гостиной.

Ma Cousin — Lomepal
Я видел Ломепала вживую на фестивале в Швейцарии прошлым летом во время грозы.Его энергия и живая версия этой песни с ударами молнии над сценой были безумными.

blun7 a swishland — tha Supreme
Переключившись на итальянский рэп, я люблю слушать эту песню, когда собираюсь утром. Это прохладный способ начать свой день и всегда поднимает настроение.

Rappeur 2 Force — Medine
Медайн — чрезвычайно сведущий французский рэпер, его тексты всегда невероятно умны. Я играл эту песню каждый раз, когда приходил на экзамен в университете.Может, поэтому я получил диплом, ха-ха.

Gravé dans la roche — S.N.I.P.E.R
Эта песня напоминает мне о доме. Я из маленькой деревни в Швейцарии, где эту песню знают не только все мои друзья, но и почему-то вся деревня. Каждый год в сентябре у нас проводится винный фестиваль, который, по сути, представляет собой целые выходные, посвященные выпивке и вечеринкам, и всякий раз, когда они играют эту песню (несколько раз за ночь), буквально все начинают петь.

Mourir sur scène — Dalida
Я играю эту песню очень громко и очень часто, а затем устраиваю представление в своей гостиной.Моя соседка по комнате, наверное, покончила с этим, но выхода нет, Далида НАВСЕГДА.

Pour que tu m’aimes бис — Селин Дион
Это действительно плейлист без песни Селин Дион? Мы с мамой всегда играем Селин Дион, когда мы вдвоем в машине и поем во весь голос. «Pour que tu m’aimes бис» вышла в 1995 году, но до сих пор остается одной из ее лучших песен.

Mother Love — Queen
Я всегда был большим поклонником Queen, и «Mother Love», наверное, моя любимая их песня.Вы можете посетить студию, где они записали большую часть своей музыки, в Монтрё, Швейцария. «Mother Love» — последняя песня, которую Фредди Меркьюри записал там, и слышать ее через звуковую систему этой студии просто потрясающе.

Yamaha — Aleksandir
Мы с братом любим превращать нашу ванную комнату в котельную, когда собираемся кататься на лыжах. Эта песня потрясающая, но она звучит еще лучше на громкоговорителе в ванной.

Careless — Cedric Zeyenne
Эта песня также всегда входит в треклист для котельной для ванной, мой брат был одержим ею прошлой зимой, поэтому теперь она напоминает мне наши рождественские каникулы в горах.

Hell, What a View — Loud
Loud — канадский рэпер из Квебека, поэтому он читает рэп как на французском, так и на английском языках. Я очень люблю все, что он делает . Парень гений.

TTTTT — Громко
Я плакал, когда увидел это вживую

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *